1. There are three general distribution patterns exhibited by individuals within a population. Aggregated or clumped distributions have
a. a variance greater than the mean b. it would depend on the species mobility c. there is no variance d. there is no variance e. a variance equal to the range

Answers

Answer 1

There are three general distribution patterns exhibited by individuals within a population. Aggregated or clumped distributions have it would depend on the species mobility. The correct answer is b.

Aggregated or clumped distributions in a population refer to the pattern where individuals are clustered or grouped together in patches or specific areas. The variance in the distribution would depend on the mobility of the species in question.

If the species has high mobility or dispersal ability, individuals may have the potential to move and disperse more widely, resulting in a larger variance in their distribution. In such cases, the clumped distribution may still exist, but the variance would be greater than the mean.

On the other hand, if the species has low mobility or limited dispersal ability, individuals may have a more restricted range of movement, resulting in a smaller variance in their distribution. In this scenario, the clumped distribution would still exist, but the variance may be smaller compared to species with higher mobility.

Therefore, the variance in the distribution of individuals within a clumped or aggregated pattern would depend on the mobility or dispersal ability of the species, making option b the correct answer.

Therefore, the correct answer is b.

Here you can learn more about clumped distributions

https://brainly.com/question/32223636#

#SPJ11  


Related Questions

I WILL MARK U BRAINLIEST

I WILL MARK U BRAINLIEST

Answers

B is correct
Because you can’t take unhealthy cells from an unhealthy cell to make it healthy there would be not cell left if you do that and the other answers don’t make sense.

How do lemon sharks affect the mangrove ecosystem?

Answers

Answer:

Research shows that when newborn lemon sharks are displaced from their natural habitat, their so-called homing behavior kicks in, and the small sharks find their way back to the exact mangrove area where they were born. This even applies when the sharks are displaced to nearby islands with similar suitable habitats

Explanation:

Are all enzymes a catalyst ? and what relation exist between catalyst and enzyme ?​

Answers

Answer:

Enzymes and catalysts both affect the rate of a reaction. In fact, all known enzymes are catalysts, but not all catalysts are enzymes. The difference between catalysts and enzymes is that enzymes are largely organic in nature and are bio-catalysts, while non-enzymatic catalysts can be inorganic compounds

Explanation:

All known enzymes are catalysts, but not all catalysts are enzymes

Catalysts are substances that increase or decrease the rate of a chemical reaction but remain unchanged. Enzymes are proteins that increase rate of chemical reactions converting substrate into product.

Which of the following is NOT a
disadvantage of nuclear power?
A. large fuel supply
B. thermal pollution
C. high construction costs
D. high environmental impact from accidents

Answers

Answer:

C. high construction costs

Explanation:

true or false a normal cardiac rhythm and stable electrocardiogram for the previous 8 hours is one of the parameters for inpatient cardiac rehabilitation daily ambulation

Answers

A normal cardiac rhythm and stable electrocardiogram for the previous 8 hours is one of the parameters for inpatient cardiac rehabilitation daily ambulation. The answer is True.

What do you mean by cardiac rhythm?

Cardiac rhythm is a result of the myocyte's inherent capacity for spontaneous depolarization. The sinoatrial node, the heart's quickest pacemaker cells, controls heart rate.

A normal cardiac rhythm and stable electrocardiogram (ECG) for the previous 8 hours is one of the parameters for inpatient cardiac rehabilitation daily ambulation.

This parameter helps ensure that the patient's heart is functioning properly and is safe for them to participate in the rehabilitation activities.

Hence, the answer is True.

To know more about cardiac rhythm

https://brainly.com/question/30264826

#SPJ11

1. Given the double-stranded stretch of DNA below, determine the base sequence of
messenger RNA strand produced using this gene as the template. *Hint: Only one of the
two strands is used as the template.
5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'

3' TACGGTAACG AATTCGCCCGTAAT ATĄGGTACT 5


AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGA

How many amino acids will this protein contain?

Answers

Answer:

AUG-CCA-UUG-CUU-AAG-CGG-GCA-ULA-UAU-CCA-UGA

so 11

Explanation:

because every 3 bases code for 1 amino acid and to make it easier to count split into 3 so u can count easily.

hope this helps :)

17. How do we get macromolecules and what do we use them for?
A.food we eat / energy only
B.air we breathe / new cells and energy
C.air we breathe / energy only
D.food we eat / new cells and energy

Answers

Answer:

D. food we eat / new cells and energy.

Answer:

b

Explanation:

googled it ;)

Which was not a source of heat for early Earth?
A.asteroid and meteorite bombardment
B.hydrothermal energy
C. gravitational contraction
D.radioactivity

Answers

Answer:

hydrothermal energy

Explanation:

It was not invented

Earth was extremely hot after it formed. There were three likely sources of this heat: Earth's gravitational contraction, radioactivity, and bombardment by asteroids, meteorites, and other system bodies.

Hydrothermal energy was not a source of heat for early earth.

What was early earth?The Earth, along with the other planets in our solar system, originated more than 4 billion years ago.The early Earth had no ozone layer and was most likely quite hot. There was also no free oxygen on the early Earth.Few things could have survived on the early Earth without an oxygen environment. Anaerobic bacteria were most likely the first living organisms on Earth.The early Earth had no seas and was constantly bombarded by meteors and asteroids. Volcanic outbursts were also common. Volcanic eruptions emitted water vapor, which cooled to form the seas.As solar radiation broke water molecules and cyanobacteria began photosynthesis, the atmosphere gradually became increasingly oxygen-rich. Eventually, the atmosphere evolved into what it is now, which is oxygen-rich.Around 2 billion years ago, the first sophisticated species appeared on Earth.

Thus, we can conclude that Option B is correct.

You can learn more about early earth here:

https://brainly.com/question/9151896

#SPJ2

I examine all the coding sequences in Diceros bicornis (Black rhinoceros) and identify each codon that translates into threonine with the following results: 25% ACA, 25% ACC, 25% ACT, 25% ACG. This results supports the conclusion that _______________.

Answers

I examine all the coding sequences in Diceros bicornis (Black rhinoceros) and identify each codon that translates into threonine with the following results: 25% ACA, 25% ACC, 25% ACT, 25% ACG. This results supports the conclusion that there is no codon usage bias.

The term "codon use bias" describes variations in the frequency at which synonymous codons appear in coding DNA. A codon is a group of three nucleotides that codes either the end of translation or a particular amino acid residue in a polypeptide chain.The occurrence of specific codons being used more frequently than other synonymous codons during the translation of genes is known as codon use bias, and its severity varies between and within species.here, each codon translating into threonine is in equal proportion ie, 25%. 25% ACA, 25% ACC, 25% ACT, 25% ACG indicate that the codons are used in equal proportion and thus there is no codon usage bias in Diceros bicornis.

learn more about codon usage bias here: https://brainly.com/question/15339928

#SPJ4

which biome has the highest soil nutrient levels? tropical rainforest boreal forest woodland/shrubland temperate seasonal forest

Answers

The biome with the highest soil nutrient levels is the tropical rainforest. This is because the tropical rainforest experiences year-round warm temperatures and high humidity, which allow for the rapid decomposition of organic matter and the release of essential nutrients into the soil.

The tropical rainforest is known for its unique and dense foliage, and it also has the highest soil nutrient levels of any biome. This is because the tropical rainforest experiences year-round warm temperatures and high humidity, which allow for the rapid decomposition of organic matter and the release of essential nutrients into the soil.

The boreal forest is another biome with relatively high soil nutrient levels. This is because the boreal forest is located in a cooler climate, and the cool temperatures slow down the decomposition process of organic matter. This allows for the retention of essential nutrients in the soil, resulting in higher nutrient levels.

Woodlands and shrublands are biomes with lower soil nutrient levels than tropical rainforests and boreal forests. This is because woodlands and shrublands are located in areas with cooler climates, and the soil is primarily composed of rock fragments and organic matter. As a result, these biomes have limited amounts of essential nutrients in the soil.

Finally, temperate seasonal forests have soil nutrient levels that are lower than tropical rainforests, boreal forests, and woodlands/shrublands. This is because temperate seasonal forests experience a wide range of temperatures, with cold winters and hot summers. The seasonal fluctuations in temperature cause the decomposition process of organic matter to be slow, resulting in lower levels of soil nutrients.

Learn more about biome at :https://brainly.com/question/11491362

#SPJ4

(iv) Plants, like all living organisms, need to excrete waste products. Explain how the excretory product of photosynthesis is removed from leaf.

Answers

Plants eliminate waste products generated during photosynthesis through a process called transpiration. The primary waste product of photosynthesis is oxygen, and it is removed from the leaf through small openings called stomata.

During photosynthesis, plants absorb carbon dioxide and release oxygen as a byproduct. Oxygen molecules diffuse out of the leaf cells and accumulate in the intercellular spaces within the leaf.

From there, oxygen moves into the stomata, which are tiny pores on the surface of leaves. Stomata are open and close to regulate gas exchange and water loss. When the stomata are open, oxygen is released into the surrounding atmosphere through diffusion, effectively removing it as a waste product.

Transpiration, the process by which water vapor evaporates from the leaf's surface, also helps in the removal of waste products. As water evaporates from the leaf through the stomata, it carries away any dissolved gases, including oxygen.

This process ensures that waste products of photosynthesis are efficiently eliminated from the leaf and allows for the exchange of gases necessary for plant respiration.

For more such answers on photosynthesis

https://brainly.com/question/19160081

#SPJ8

Which of the following build(s) new strands of DNA?
A). The origins of replication
B). DNA polymerases
C). Parental DNA
D). The leading strand
E). The lagging strand

Answers

New strands of DNA is formed by DNA polymerases.

What is DNA?

Deoxyribonucleic acid is a polymer consisting of two polynucleotide chains that coil around one another to form a double helix. Genetic material included in all recognized creatures, including many viruses, is essential to their growth, development, function, and reproduction. DNA and ribonucleic acid are examples of nucleic acids.

The molecule that carries the genetic information required for an organism to grow and function is called deoxyribonucleic acid, or DNA. A double helix, which is made up of two linked strands that loop around one another to resemble a twisted ladder, is the shape of DNA.

Hence the correct option is b).

To learn more about DNA, here

https://brainly.com/question/264225

#SPJ1

the triads of a muscle fiber consist of __________.

Answers

A triad is made up of three notes stacked in subsequent thirds. A triad is also known as a harmony or a chord. (Chord progressions are another example of harmony.) The root is the lowest note of a triad when it is stacked in thirds.

What the triads of a muscle fiber posses?

The terminal cisterna, T-tubule, and sarcoplasmic reticulum are the three structures that surround the myofibrils and make up the triad.

Therefore, Actin and myosin, two protein structures, are found in the myofibrils. In a muscle cell, the sarcomere serves as a structural and functional unit.

Learn more about muscle fiber here:

https://brainly.com/question/1426285

#SPJ1

Identify the results of a substance losing energy. Select all that apply.
A. The temperature of the substance will increase.
B. The substance will change from the gaseous state to the liquid state.
C. The temperature of the substance will decrease.
D. The substance will change from the solid state to the liquid state.

Answers

B and C

When particles get colder and lose energy, they begin to move less and less. Gas particles move the most, with solid particles moving the least. So, it makes sense that if the substance loses energy and gets colder, it will also transform from gaseous state to liquid state since the particles are also moving slower as a result of it losing energy.

Hope this helped!

identify 3 reasons why cells divide? please explain.​

Answers

Answer:

1 growth, 2 replace, and 3 reproduction.

Explanation:

1. Go from one cell/( zygote to a trillion)

2. Repair 50 million cells die second.

3. ( make cells for reproduction make specialized sex cells)

Are there multiple of one organelle in a cheetah cell?
Need an answer QUICK!!!

Answers

Answer:

yes

Explanation:

they have multiple

Answer:

Yes

Explanation:

Yes

Yes

Yes

YES!!!!

how can you prevent transmission of cholera from a patient to a healthy person?

Answers

Description:

To prevent transmission of cholera from a patient to a healthy person you should use safe water meaning clean water. Wash your hands with clean water with soap. Also cook food well mostly see food including fish

Answer:

Use safe water

Wash your hands with soap and clean water

Cook well mostly see food including fish

Please mark brainliest

Hope this helps.

Some students were building a model of a
digestive system. Which choice best
describes a process they should show with
their model?
F Tissues digest food for the organ
system to absorb.
GCells digest food, which is then
absorbed by organs.
Organs digest food by working
together as a system.
(H)
The organ system uses specialized
cells to digest food.

Answers

The digestive process is divided into four steps: ingestion, chemical and mechanical food breakdown, nutrient absorption, and expulsion of indigestible food.

What does the digestive process entail?

The digestive process starts as soon as something is chewed. In order for food to pass more easily through your esophagus and into your stomach, saliva, a digestive juice produced by your salivary glands, moistens the food. The carbs in food also begin to be broken down by an enzyme found in saliva.

Motility, digestion, absorption, and secretion are the four fundamental functions of the digestive system. Our digestive system transforms our food into energy that we can use.

The digestive system's initial function is to take in food through the mouth. The "ingesting" procedure must take place before anything else can happen.

The complete question is:

Some students were building a model of a digestive system. Which choice best describes a process they should show with their model?

a) F Tissues digest food for the organ system to absorb.

b) G Cells digest food, which is then absorbed by organs.

c) Organs digest food by working together as a system.

d) The organ system uses specialized cells to digest food.

To learn more about digestive system refer to:

brainly.com/question/956634

#SPJ1

How much can edge computing change network latency?

Answers

Between 6% to 10% edge computing can change network latency.

Edge computing aims to control the massive data streams produced by IoT devices and enable applications with strict latency requirements, such as augmented reality. Bringing computing from a remote cloud closer to service users and data producers is a fundamental tenet of this paradigm.

The placement of edge computing facilities becomes a problem as a result. We give a thorough analysis outlining possible locations for general-purpose edge computing resources over the whole Internet. Our findings are supported by comprehensive measurements of actual networks.

We carry out in-depth traceroute measurements from RIPE Atlas to US data centers, producing an 11K router graph. To identify the network providers that potentially serve as edge providers, we establish the affiliations of the routers.

Learn more about edge computing here:

https://brainly.com/question/28256857

#SPJ4

13-15.) In proton-beam therapy, a high-energy beam of protons is fired at a tumor. As the protons stop in the tumor, their kinetic energy breaks apart the tumor's DNA, thus killing the tumor cells. Fo

Answers

Proton-beam therapy is a type of radiation therapy used to treat cancer. In this therapy, a high-energy beam of protons is directed at a tumor. The protons have a specific range in tissue, and they stop inside the tumor, delivering most of their energy at the tumor site.

The main advantage of proton-beam therapy over traditional radiation therapy is that it can deliver a high dose of radiation to the tumor while minimizing damage to the surrounding healthy tissues. This is because protons have a unique physical property called the Bragg peak, which allows them to deposit their maximum energy at a specific depth within the tissue.

When the high-energy protons stop in the tumor, their kinetic energy is transferred to the tumor cells. This energy breaks apart the tumor's DNA, which is responsible for the cells' ability to grow and divide. By damaging the DNA, the tumor cells are unable to replicate and eventually die.

It is important to note that proton-beam therapy is a complex and specialized treatment that requires careful planning and precise delivery. It is typically used for tumors located near critical structures, such as the brain or spinal cord, where minimizing damage to surrounding tissues is crucial.

In summary, proton-beam therapy uses high-energy protons to deliver radiation to tumors, damaging their DNA and killing the tumor cells. This treatment offers the advantage of delivering a focused dose of radiation while minimizing harm to healthy tissues.

To know more about Proton-beam therapy, visit:

https://brainly.com/question/32472837

#SPJ11

A botanist crosses two pink-flowered plants. The cross is a case of intermediate inheritance that involves alleles that were not clearly dominant or recessive and could make red-, pink-, and white-flowered plants. If four plants are produced from the cross, what is the expected number of white-flowered plants?
A-1
B-0
C-3
D-2

Answers

A:1 why because when crossing u get one white 2 pink and 1 red

Pablo places a spoon in a cup of hot water. He observes that the temperature of the spoon increases as it gains heat. What is the BEST conclusion that can be drawn from this experiment? A. Temperature is another type of heat energy. B. Heat and temperature cannot be transferred. C. Heat is the measure of the temperature of a substance. D. Temperature measures the effect of heat on the particles of a substance.

Answers

Correct me if I am wrong but I believe the answer you are looking for is c

(Help) Why are the cells produced by meiosis considered gametes?

Answers

gametes are cells used to sexual reproduction. they are haploids and that means they have just one set of chromosomes (most of the cells of our body have 2 sets). that kind of cells is produced mainly by meiotic division of the gamete's stem cell (called oogonium or spermatogonium) and that's why meiosis usually leads to the production of gametes. gametes are haploids so that they could combine (egg with sperm cell) and create the whole new organism (adult organism is almost always diploid).

Biology 1
Please help >~

Biology 1 Please help >~

Answers

Answer:

C :D

Explanation:

Answer:

d

Explanation:

i hope this helps

Natasha has a short stature, although everyone in her family is tall. Unlike her family members and relatives, she has a webbed neck. She dislikes mathematics as she has difficulty understanding the subject. However, she takes part in and enjoys activities that require verbal communication. Natasha's doctor informs her parents that she is missing an X chromosome, making her XO instead of XX. The symptoms and the cause of the symptoms most likely indicate that Natasha has____. Multiple Choice a. Fragile X syndrome b. XYY syndrome c. Klinefelter syndrome d. Turner syndrome

Answers

Natasha most likely has Turner syndrome.

Turner syndrome, also known as 45,X or monosomy X, is a genetic disorder that affects females. It is characterized by the absence of one of the X chromosomes, resulting in an XO chromosomal pattern instead of the typical XX pattern. This condition can lead to various physical and developmental features, which align with the symptoms described for Natasha.

One of the key features of Turner syndrome is short stature, as seen in Natasha's case. Despite having tall family members, her lack of growth can be attributed to the absence of an X chromosome. Additionally, the mention of a webbed neck is also a common characteristic of Turner syndrome. This webbing occurs due to extra folds of skin on the sides of the neck, giving it a "webbed" appearance.

Another aspect mentioned is Natasha's dislike and difficulty with mathematics. While this is not a direct symptom of Turner syndrome, learning difficulties, particularly in spatial and mathematical areas, can be present in individuals with the condition. It is important to note that these learning difficulties can vary among affected individuals.

On the other hand, Natasha's enjoyment of activities that require verbal communication aligns with the strengths often seen in individuals with Turner syndrome. They tend to have good verbal skills and may excel in areas such as language, social interaction, and verbal expression.

In conclusion, based on the symptoms described (short stature, webbed neck, difficulty with mathematics but good verbal communication skills), the most likely diagnosis for Natasha is Turner syndrome.

Turner syndrome, also known as 45,X or monosomy X, is a genetic disorder that affects females. It is caused by the absence of one X chromosome, resulting in an XO chromosomal pattern instead of the typical XX pattern. The condition can have various physical and developmental features. One of the most common characteristics is short stature, where affected individuals tend to be shorter than average. Another notable feature is a webbed neck, which refers to the excess folds of skin on the sides of the neck, giving it a web-like appearance.

In addition to these physical features, individuals with Turner syndrome may also experience certain learning difficulties. While not all individuals are affected in the same way, some may struggle with spatial and mathematical concepts. On the other hand, they often exhibit strengths in verbal communication, language skills, and social interaction. This could explain Natasha's dislike for mathematics but her enjoyment of activities that require verbal communication.

It is important to note that Turner syndrome can have varying effects on individuals, and not everyone will display the same set of symptoms. Therefore, a thorough medical evaluation and genetic testing are necessary for an accurate diagnosis. Early intervention and appropriate management can help address any potential challenges and ensure the overall well-being of individuals with Turner syndrome.

Learn more about  Turner syndrome

brainly.com/question/31674781

#SPJ11

iii) suggest how the actual genotype of the albino parent could be determined.

Answers

Cross the albino parent with a black individual aaDd/aaDD (homozygous for yellow banding)

If genotype is Aadd, there will be agouti offspringIf genotype is aadd no offspring produced with be agouti.

The transmission of features or information from one generation of persons or cells to the next is referred to as inheritance. Inheritance can occur through one of two mechanisms: genetic inheritance or epigenetic inheritance. Part of the molecular underpinning of inheritance is the study of genes, genetic variations, and heredity. It explains why a child resembles his or her parents. The molecular basis of heredity is built on DNA, RNA, and genetic code. They pass down genetic genes from parents to kids.

For single-gene illnesses, there are four primary patterns of inheritance: autosomal dominant, autosomal recessive, X-linked dominant, and X-linked recessive. However, these patterns do not apply to all genetic disorders, and other uncommon kinds of inheritance, such as mitochondrial inheritance, exist.

To learn more about inheritance of genes, here

https://brainly.com/question/28291968

#SPJ4

if the ph of the rough er were higher than normal, what might be expected of the fate of proteins bearing the kdel sequence?

Answers

If the ph was higher in the rough endoplasmic reticulum, the deproteination of the kdel sequence would occur.

The endoplasmic reticulum is an organelle found in the cells of both plants and animals. The endoplasmic reticulum is further divided into two categories depending upon the presence of ribosomes.

The endoplasmic reticulum that contains ribosomes on its surface is called a rough endoplasmic reticulum while the one without it is known as the smooth endoplasmic reticulum.

The rough endoplasmic reticulum, due to the presence of ribosomes plays an important role in protein formation.

The process of protein formation, especially that of the kdel sequence is ph dependent. If the ph were higher than that required, the kdel proteins would end up forming stable compounds with the Golgi lumen.

The receptors activated in the Golgi membrane start the process of retrograde transport. (transport back to other cell bodies from the receptor.)

The acidic ph in the rough endoplasmic reticulum causes the deproteination of the complex from which the receptor is released and transported back to the Golgi body. While the kdel peptides get freed from the cargo proteins.

Learn more about rer-golgi complex at:

brainly.com/question/13458424

#SPJ4

The 8th cranial nerve
A) is a sensory nerve that comes from the ear.
B) carries auditory information.
C) carries vestibular information
D) all of the above
E) both A and B

Answers

The answer is D all of the above

what are reasons to be concerned about the loss of biodiversity worldwide? multiple select question.

Answers

Reasons to be concerned about the loss of biodiversity worldwideThe phrase biodiversity describes the diversity of life on Earth at all scales, from genes to ecosystems, and can also include the ecological, evolutionary, and cultural processes that support life.

The most intricate and crucial aspect of our world is its biodiversity.These frequently function as a component of a methodical endeavor that results in a significant alteration of a landscape's or a region's ecological trajectory. In order to obtain and produce food, alter the landscape to accommodate human settlement, and create possibilities for trading with other people in order to increase wealth, humans may alter the terrestrial and aquatic ecosystems they depend on as human populations increase. Usually, these processes are accompanied with biodiversity losses.

Learn more about biodiversity by using this link:

https://brainly.com/question/23101752

#SPJ4

Which if the following is NOT a carbohydrate

A. Cellulose
B. Lipids
C. Monosaccharides
D. Starch

I think it's C

PLEASE HELP!!!

Answers

Answer:

Here gulcose, maltose, and fructose are carbohydrate. Glycine is not a carbohydrate

Explanation:

have a nice day

Other Questions
indirect objects pronouns tend to replace: 4. Why did Sal's father start chipping away at the plaster in the house in Kentucky? ne was waiting for Sals mom come back. Choose all of the following that are domestic factors that can encourage economic growth.-a strong infrastructure-a commitment to private property rights-public confidence in the government-a tropical environment 2)A relatively unreactive metal that is yellow colored.3)An unreactive gas found in period 1.4)Group 16, period 3.5)Group 2, period 5.6)A metal that would produce H2 gas when placed in water tha In a lawsuit, a defendant can file a ______ if the defendant believes that the plaintiff has caused her damages arising out of the same set of facts. Help me please find the answer someone Help if u know the answer pls put the step by step 6 = v-2 which of these guidelines should you follow as you prepare report recommendations? check all that apply. do not sensationalize or exaggerate the findings begin each recommendation with a verb provide readers with ideas for implementation include conclusions with your recommendations confirm that your recommendations are the result of logical analysis Calculate the net income (after tax) to the net sales (round to nearest hundredth). for 2015 and 2014 ?LOGIC COMPANYComparative Income StatementFor Years Ended December 31, 2014 and 201520152014Gross sales$19,000$ 15,000Sales returns and allowances1,000100Net sales$18,000$ 14,900Cost of merchandise (goods) sold12,0009,000Gross profit$6,000$5,900Operating expenses:Depreciation $700$600Selling and administrative2,2002,000Research550500Miscellaneous360300Total operating expenses $ 3,810$ 3,400Income before interest and taxes $2,190$2,500Interest expense560500Income before taxes$1,630$2,000Provision for taxes640800Net income$990$1,200LOGIC COMPANYComparative Balance SheetDecember 31, 2014 and 201520152014AssetsCurrent assets:Cash$ 12,000$9,000Accounts receivable16,50012,500Merchandise inventory8,50014,000Prepaid expenses24,00010,000Total current assets $61,000$45,500Plant and equipment:Building (net)$14,500$11,000Land13,5009,000Total plant and equipment $28,000$20,000Total assets$89,000$65,500LiabilitiesCurrent liabilities:Accounts payable$13,000$7,000Salaries payable7,0005,000Total current liabilities$20,000$12,000Long-term liabilities:Mortgage note payable22,00020,500Total liabilities$42,000$32,500Stockholders? EquityCommon stock$21,000$21,000Retained earnings26,00012,000Total stockholders? equity $47,000$33,000Total liabilities and stockholders? equity$ 89,000$65,500 Given the graph of g(x), describes the transformation of the parent function f(x)=2^x Fill in the blank with the correct term or number to complete the sentence.Volume is the amount of _____ inside a three-dimensional figure.A.spaceB.lengthC.heightD.widthPLS ASAPPPP!!!!!!!! i will give brailest b) Calculate the average distance among the electrons for a 1 nm2 probe with a total current of 100 nA: 1) 30 keV electrons and 2) 0.1 keV electrons. (10 points) Hint 1: you can assume that the electrons are uniformly distributed both laterally and along the electron beam direction. Hint 2: you do not need to consider the space-charge effects (including the Boersch and Loeffler effect) due to electron-electron interactions within the probe. Hint 3: for simplicity, you can assume that the electrons are traveling with a convergence angle = 0. Therefore, you can view the electron beam as a cylinder-like beam. - a client reports a burning sensation when urinating for the first time following the removal of an indwelling urinary catheter. in this situation, what would be the nurse's intervention? Afghanistan was harboring al qaeda terrorists. In the preceding sentence, what does to harbor mean?. what can a geologist understand by studying the fossil composition of sedimentary rocks? responses a business cycle is: group of answer choices a very deep and prolonged economic downturn. a period in which output and employment are rising. a period in which output and employment are falling. a short-run alternation between economic upturns and downturns. Create Pronoun-Antecedent AgreementCreate pronoun-antecedent agreement by adding appropriate pronouns to the following statements.President Kennedy was elected in 1960, but delivered his inaugural address in 1961. Which of the following best summarizes one central idea of the passage from "Mother Tongue"?All forms of the English language are meaningful and purposeful.Some forms of the English language do not translate well into writing.The English language would be more efficient with a Chinese structure.English language proficiency can only be determined through testing. Analyze each situation. Identify a reasonable domain and range for each situation. Explain.a. A bowler pays $2.75 per game.b. A car travels 25 miles using 1 gallon of gas. they say to "Use the Distributive Property to expand 4(2.9x- 7.8y) -6." and i dont get it someone please help