the mannose-6-phosphate receptor would have what type of protein tag?
The mannose-6-phosphate receptor (M6PR) is a type of receptor protein that recognizes and binds to proteins containing mannose-6-phosphate (M6P) tags.
The M6P tag acts as a specific targeting signal for proteins destined to be transported to lysosomes. The M6P tag is added to proteins during their synthesis in the Golgi apparatus. Enzymes in the Golgi modify specific sugar residues on the proteins, resulting in the addition of M6P tags. These M6P tags serve as recognition signals for the M6PR.
The M6PR is a transmembrane protein that is localized on the membrane of various cellular compartments, including the Golgi apparatus and endosomes. It has a specific binding domain that interacts with the M6P tag on the target proteins, allowing for their selective uptake and transport to the lysosomes.
Therefore, the M6PR recognizes and binds to proteins with the M6P tag, enabling their proper sorting and delivery to lysosomes for degradation or processing.
To know more about M6P click here:
https://brainly.com/question/30901806
#SPJ11
What is the difference between lipid hormones and protein hormones?
a. Protein hormones diffuse directly through the target cell and begin a signal transduction pathway with a series of chemical
messengers or enzymatic reactions of the target cell.
b. Lipid hormones diffuse directly through the target cell and begin a signal transduction pathway with a series of chemical
messengers or enzymatic reactions of the target cell.
c. Lipid hormones bind to a receptor to enter the target cell and begin a signal transduction pathway with a series of chemical
messengers or enzymatic reactions of the target cell.
d. Protein hormones bind to a receptor to enter the target cell and begin a signal transduction pathway with a series of chemical
messengers or enzymatic reactions of the target cell.
Answer:
plz plz follow me. ........
..
.......
which part of the nervous system contains the brain and spinal cord; processes, stores, and responds to information from the peripheral nervous system
a. The central nervous system consists of the brain and spinal cord.
b. The peripheral nervous system consists of nerves that branch off from the spinal cord and extend to all parts of the body.
c. The nervous system transmits signals between the brain and the rest of the body, including the internal organs.
d. all answers are correct
a.The central nervous system consists of the brain and spinal cord.The brain and spinal cord are the two components of the central nervous system.
The peripheral nervous system is composed of nerves that emerge from the spinal cord and cover the entire body. The majority of your senses are fed information by PNS into your brain. You can move your muscles thanks to the signals it transmits. The brain uses signals from your PNS to command essential, automatic functions like breathing and pulse. An upper motor neuron transmits motor information from a region of the brain down the spinal cord. From the brain to the brainstem, upper motor neurons can also travel.
To know more about nervous system, click here:
https://brainly.com/question/29355295
#SPJ4
The diagram shows the process of translation.
How does a tRNA molecule know to stop translation?
Responses
Enzymes gradually break down the mRNA molecule.
Enzymes gradually break down the , m R N A, molecule.
Amino acid chains can only be made of a certain number of nucleotides, and the tRNA stops when that number is reached.
Amino acid chains can only be made of a certain number of nucleotides, and the , lowercase t uppercase R N A, stops when that number is reached.
It reaches a stop codon on the mRNA.
It reaches a stop codon on the , m R N A, .
A specially shaped tRNA molecule binds to the mRNA.
The tRNA molecule knows to stop translation Stop Codons Mark the End of translation. It reaches a stop codon on the mRNA.
How does a tRNA molecule know to stop translation?The end of the protein-coding message is motioned by the presence of one of three codons (UAA, UAG, or UGA) called stop codons. These are not accepted by a tRNA and do not state an amino acid, but instead signal to the ribosome to stop translation.
Translation ends in a procedure called termination. Termination happens when a stop codon in the mRNA (UAA, UAG, or UGA) undertakes the A site.
So we can conclude that No tRNAs in the cell have anticodons that companion any of the three feasible stop codons.
Learn more about translation here: https://brainly.com/question/1574635
#SPJ1
many hormones are measured for diagnostic reasons by using the plasma levels of the hormones. what is used today to measure plasma hormone levels?
Today, immunoassay techniques such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA) are commonly used to measure plasma hormone levels for diagnostic purposes.
These methods rely on the specific binding between a hormone and its corresponding antibody to detect and quantify the hormone in the sample. Other techniques, such as mass spectrometry, are also used for hormone analysis, particularly in research settings.
Today, to measure plasma hormone levels, a common method used is enzyme-linked immunosorbent assay (ELISA). ELISA is a sensitive and reliable technique that detects and quantifies hormones in plasma samples by utilizing specific antibodies and enzymes for each hormone of interest.
Learn more about enzyme-linked immunosorbent assay here:-
https://brainly.com/question/13252906
#SPJ11
Summarize How cells divide
The most common predator of the Northern Pike fish is humans, who enjoy the sport of catching this fast swimmer along with consuming their catch. These fish seek areas of dense vegetation or shallow water that is covered and stays cool. A certain lake with a large pike population becomes isolated due to development that eliminates the road leading to the lake. After several years what explains the population changes seen in the graph?
Answer:
C
Explanation:
The body will expend about ____ calories for every liter of oxygen consumed.
a. 2
b. 5
c. 7
d. 10
e. 12
The body will expend about 5 calories for every liter of oxygen consumed.
This is known as the respiratory quotient (RQ), which is the ratio of carbon dioxide produced to oxygen consumed during metabolism. The RQ for carbohydrates is 1, meaning that one molecule of glucose consumes one molecule of oxygen and produces one molecule of carbon dioxide. The RQ for fats is 0.7, meaning that one molecule of fat consumes 0.7 molecules of oxygen and produces one molecule of carbon dioxide.
The RQ for proteins varies depending on the type of amino acids, but on average it is around 0.8. By measuring the RQ, scientists can determine the type of fuel (carbohydrates, fats, or proteins) being used by the body during exercise or other activities. Overall, the body's energy expenditure is influenced by many factors, including age, gender, weight, and activity level.
Learn more about amino acids at:
https://brainly.com/question/31872499
#SPJ11
why is left lung smaller than right lung
Answer:
I guess I should guess sit correct.
Explanation:
if the left lung's size is equal to the right lung's size, then there wont be any space for the heart.
so the space left on your left lung is occupied by the heart.
hope it helps :)
Mendelian ratios are modified in crosses involving autotetraploids.
Assume that one plant expresses the dominant trait green seeds and is homozygous (WWWW). This plant is crossed to one with white seeds that is also homozygous (wwww).
1. If only one dominant allele is sufficient to produce green seeds, predict the F1 phenotypic ratio of such a cross. Assume that synapsis between chromosome pairs is random during meiosis.
2.Predict the phenotypic ratio of the F2 generation.
____ green : ____ white
3. Having correctly established the F2 ratio in Part B, now predict the F2 phenotypic ratio of a "dihybrid" cross involving two independently assorting genes, A and W, for this cross.
WWWWAAAA x wwwwaaaa
The F2 ratio would be:
____ dominant W and dominant A individuals :
____ dominant W and recessive a individuals :
____ recessive w and dominant A individuals :
____ recessive w and recessive a individuals
Phenotypic ratio of F1 is 4:0 (green: white seeds). Phenotypic ratio of F2 is 9:7 (green: white seeds). Phenotypic ratio of F2 of dihybrid cross = 9:3:3:1.
What is the phenotypic ratio?The F1 phenotypic ratio will be all green seeds, as only one dominant allele is sufficient to produce green seeds. This will result in a phenotypic ratio of 4:0 green: white seeds.
F2 Phenotypic ratio for the F2 generation, we will get a phenotypic ratio of 9:7 green: white seeds.
Parents- WWWW x A genotype produces all WAWA gametes, while wwww produces all wawa gametes. On crossing these parents, hybrid produced will be:
WWAW x wawA
Offspring genotypes: WWAW – green, WWAw – green, WwAW – green, WwAw – green, WWaA – green, WwaA – green, Wwaa – white, wwAW – white, wwAw – white, wwaA – white, wwaa – white.
F2 Phenotypic ratio of a dihybrid cross, the ratios are as follows
Parents - WWWWAAAA x wwwwaaaa
The possible gametes from the WWAW genotype are WAWA, WAWa, WaWA, and WaWa. The wawa genotype produces only wawa gametes. The multiplication of these two results in the following:
WWAW x wawa = WAWAaWAWa x wawa = WAWaaWaWA x wawa = WaWAWawa x wawa = WaWaWaAW x wawa = WawaAaWaAw x wawa = Wawaa waWA x wawa = waWAwawa x wawa = wawa
The phenotypic ratio will be the same as the F2 generation’s phenotypic ratio, which is 9:7 green: white seeds.
The F2 ratio would be 9 dominant W and dominant A individuals: 3 dominant W and recessive a individuals: 3 recessive w and dominant A individuals: 1 recessive w and recessive a individuals.
Learn more about Phenotypic ratio here:
https://brainly.com/question/11552649
#SPJ11
ok guys i have a question on a tst and it will make or brake my grade plz help
Two students were engaged in a discussion about photosynthesis & cellular respiration. Which of the following statements made is the most accurate? * 1 point Photosynthesis and respiration are the same processes. Photosynthesis and respiration do not have anything to do with energy Photosynthesis releases energy from food and respiration produces food. Photosynthesis produces food and respiration releases energy from food.
Try to study more next time
Please help me fast ………
Answer: B
Explanation:
how is carbon moved through the carbon cycle through the process of photosynthesis and cellular respiration
Answer:
Through the process of photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth. Carbon moves from plants to animals. Through food chains, the carbon that is in plants moves to the animals that eat them. Animals that eat other animals get the carbon from their food too.
all known creatures that have amniotic eggs also have
All known creatures that have amniotic eggs also have the following characteristics:
Amniotic Membrane: All animals that lay amniotic eggs have an amniotic membrane that surrounds the embryo, providing protection and allowing gas exchange. This membrane also contains amniotic fluid, which provides a cushion for the developing embryo.
Chorion: All amniotic eggs also have a chorion, which is a membrane that surrounds the amniotic membrane. The chorion is involved in gas exchange and waste removal, and it helps prevent dehydration of the embryo.
Allantois: All known creatures that lay amniotic eggs also have an allantois, which is a membrane that stores waste products produced by the developing embryo. The allantois also helps with gas exchange and may contribute to the formation of blood vessels.
Yolk Sac: All amniotic eggs also have a yolk sac, which is a membrane that contains the yolk, a nutrient-rich substance that provides food for the developing embryo.
These characteristics are common to all amniotes, including reptiles, birds, and mammals.
To know more about amniotic eggs refer here
brainly.com/question/31446677#
#SPJ11
Can someone please help
Answer:
P = 0.79.
Explanation:
To solve this, we need to understand the Hardy-Weinburg equation and what each variable is. P is usually used for the dominant trait classification (in this case, it would be long legs) and Q is usually used for the recessive trait classification (in this case, it would be short legs).
Therefore, we know that the values have to add up to 1 and that Q is recessive and P is dominant. So, if we begin applications, we can learn that to equal 1, we must use numbers less than 1 to accomplish this.
If 21 of a 100-person population have short legs, then ideally, 79 people would have long legs (the dominant trait). So, we know that 0.21 as q and 0.79 as p would equal 1 if you just added p and q together. Therefore, we can know that q is 0.21 and p is 0.79.
To prove this, we can insert these values into the equation:
\(0.79^{2} + 2(0.79*0.21) + 0.21^{2} =1\)
\(0.6241 + 0.3318 + 0.0441 =1\)
\(1=1\)
Please help!!
response, be sure to answer all parts of the question. If the prompt asks you to describe, predict, infer, compare, analyze, list or identity, be sure to do just that. Be sure to put answers to ALL questions in The expectation is that you have one sentence for CLAIM, one or more for EVIDENCE
and one or more for REASONING for a total of 3 or more sentences in your answer.
PROMPT: During the formation of the Grand Canyon, a population of squirrels was
separated. Over time the squirrels, separated by the canyon walls and the Colorado River,
became two unique species. The Albert's squirrel population, which has grey fur was divided
and separated long enough that speciation was able to occur. A new species, Kaibab
squirrel which has black fur and a completely white fluffy tail developed distinct
characteristics to its new environment. Members of these two species have a similar size,
shape and diet but they are no longer in contact with each other and have become so
different that they are now unable to interbreed. Why did one species of squirrel become
two unique species?
Answer:
Claim: The separation of the squirrels by the Grand Canyon and the Colorado River led to the formation of two unique species of squirrels.
Evidence: The Albert's squirrel population, which initially had grey fur, was divided and separated by the canyon walls and the Colorado River for a significant period of time, allowing for speciation to occur. Similarly, the Kaibab squirrel, which has black fur and a completely white fluffy tail, developed distinct characteristics in response to its new environment.
Reasoning: The separation of these two squirrel populations prevented them from interbreeding and allowed for genetic divergence to occur, leading to the development of distinct characteristics and the formation of two separate species. This demonstrates the important role that geographic isolation can play in the process of speciation.
Explanation:
Is this okay?
explain the role of complementary base pairing in dna replication.
The role of complementary base pairing in DNA replication is to ensure the accurate copying of genetic information. adenine (A) always pairs with thymine (T), and guanine (G) always pairs with cytosine (C). This specific pairing allows for the faithful transmission of genetic information from one generation to the next.
In DNA replication, complementary base pairing plays a crucial role in ensuring the accurate copying of genetic information. The DNA molecule consists of two strands that are held together by hydrogen bonds between the nucleotide bases. These bases include adenine (A), thymine (T), guanine (G), and cytosine (C).
During replication, the two strands of the DNA molecule separate, exposing the nucleotide bases. Each strand then serves as a template for the synthesis of a new complementary strand. Complementary base pairing occurs when adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C). This pairing is specific and follows the rules of base pairing.
The enzyme DNA polymerase adds nucleotides to the growing DNA strand, using the existing strands as a template. It ensures that the new nucleotides are complementary to the exposed bases on the template strand. For example, if the template strand has an adenine (A), DNA polymerase will add a thymine (T) to the new strand.
By following the rules of complementary base pairing, DNA replication ensures that the genetic information is faithfully copied. Each new DNA molecule formed during replication contains one original strand and one newly synthesized strand. This process allows for the accurate transmission of genetic information from one generation to the next.
Learn more:About complementary base pairing here:
https://brainly.com/question/30134242
#SPJ11
Complementary base pairing plays a critical role in DNA replication, which is the process by which DNA makes copies of itself.
The complementary base pairing ensures the accurate and faithful replication of the genetic information.
During DNA replication, the double-stranded DNA molecule unwinds and separates into two individual strands. Each separated strand then acts as a template for the synthesis of a new complementary strand.
The process of complementary base pairing occurs as follows:
1. DNA unwinding: Enzymes called helicases unwind and separate the double-stranded DNA molecule, breaking the hydrogen bonds between the base pairs. This creates a replication fork, with two single strands of DNA exposed.
2. Primer binding: Primers, short RNA or DNA sequences, bind to the template DNA strands at specific sequences called origins of replication. The primers provide a starting point for DNA synthesis.
3. Complementary base pairing: DNA polymerases, enzymes responsible for DNA synthesis, recognize the exposed template strands and begin adding nucleotides to synthesize the complementary strands. The polymerases add nucleotides in the 5' to 3' direction, matching the template strand.
- Adenine (A) pairs with thymine (T) using two hydrogen bonds.
- Cytosine (C) pairs with guanine (G) using three hydrogen bonds.
As the polymerases move along the template strands, they read the existing nucleotides on the template and incorporate the complementary nucleotides into the newly synthesized strands.
4. DNA strand elongation: The polymerases continue adding nucleotides to the newly synthesized strands, extending them in the 5' to 3' direction. This process occurs simultaneously on both template strands, resulting in the formation of two identical daughter DNA molecules.
By ensuring complementary base pairing, DNA replication maintains the integrity and fidelity of the genetic information. The specific base pairing rules guarantee that each newly synthesized strand is an accurate replica of the original template strand. This process is crucial for the transmission of genetic information from one generation to the next and for the preservation of genetic stability.
To know more about DNA replication, visit:
https://brainly.com/question/30111562#
#SPJ11
Describe how Stella’s view of these plant cells and their parts changed as she transitioned through the three levels of magnification. Be sure to identify at least one cell structure or part of the leaf cells in your description.
Answer:
From lower to higher level of magnification, the stella's view about plant cells.
Explanation:
At lower magnification, the structure of plant cell is not clear by stella but with the increase of magnification, the cell structure becomes enlarge and clearly seen different structures of plant cell by the individual. The boundary of plant cell is known as epidermis. The upper boundary of plant cell is upper epidermis and the lower boundary of plant cell is lower epidermis.
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
a normal cell that sustains irreparable dna damage will most likely __________.
A normal cell that sustains irreparable DNA damage will most likely undergo apoptosis.
Apoptosis is a process of programmed cell death that occurs in response to a variety of stimuli, including DNA damage, cellular stress, or developmental cues.
In the case of irreparable DNA damage, the cell undergoes a series of molecular events that ultimately lead to its death.
This is an important mechanism for removing damaged or abnormal cells from the body, and helps to prevent the development of cancer and other diseases.
If apoptosis fails, damaged cells may continue to proliferate and accumulate genetic mutations, increasing the risk of malignant transformation and tumor formation.
To learn more about DNA, click here:
https://brainly.com/question/264225
#SPJ11
What is an earthquake?
define it
Answer:
An earthquake is a sudden and violent shaking of the ground caused by the movement of tectonic plates beneath the Earth's surface. Tectonic plates are massive slabs of rock that make up the Earth's crust and are constantly moving and shifting. When the plates collide or slide against each other, they can create a release of energy in the form of seismic waves that cause the ground to shake.
The magnitude, or strength, of an earthquake is measured on the Richter scale, which ranges from 0 to 10. Earthquakes with a magnitude of 4.5 or greater can cause significant damage, while those with a magnitude of 7.0 or greater can be catastrophic and cause widespread destruction.
Earthquakes can occur anywhere in the world, but are most common in areas where tectonic plates meet or where there are active faults. They can also be triggered by human activities such as mining, drilling, and the construction of large dams.
Controls the entry of chyme into the duodenum - Controls the entry of chyme into the colon - Substance that helps make or break a chemical bond - A component of gastric juice - Organ that releases bile into the small intestine - Organ that synthesizes bile - Fingerlike projection of small intestinal lining - Absorption mechanism that requires energy - Absorption mechanism that does not require energy - Carries fat-soluble vitamins
A. Pylorus
B. Active transport
C. Diffusion
D. Villus
E. Gallbladder
F. Lymphatic system
G. Hydrochloric acid
H. Ileocecal valve
I. Enzyme
J. Liver
Answer:
- Controls the entry of chyme into the duodenum: A. Pylorus
- Controls the entry of chyme into the colon: H. Ileocecal valve
- Substance that helps make or break a chemical bond: I. Enzyme
- A component of gastric juice: G. Hydrochloric acid
- Organ that releases bile into the small intestine: E. Gallbladder
- Organ that synthesizes bile: J. Liver
- Fingerlike projection of small intestinal lining: D. Villus
- Absorption mechanism that requires energy: B. Active transport
- Absorption mechanism that does not require energy: C. Diffusion
- Carries fat-soluble vitamins: F. Lymphatic system
Explanation:
The pylorus is a part of the digestive system that connects the stomach to the duodenum. The ileocecal valve is a muscle localized between the ileum of the small intestine and the colon, whose main function is to limit the reflux of colonic contents. Gastric juice is a liquid consisting of hydrochloric acid, lipase, and pepsin, whose main function is to inactivate microorganisms. The gallbladder is a small organ that in combination with the small intestine are reservoirs for bile acid and regulate the biliary secretion of this acid. The bile acid is a fluid secreted by the liver that helps to digest lipids in the small intestine. Intestinal villi (villus in singular) are finger-like projections that increase the surface area for the absorption of nutrients in the small intestine. Active transport is the movement of molecules across cell membranes by using energy from ATP hydrolysis or by using an electrochemical gradient. Diffusion is the movement of molecules across cell membranes from a side of the membrane with higher concentration to the other side with lower concentration. An enzyme is a molecule (generally a protein) that is capable of accelerating the rate of a chemical reaction. Fat-soluble vitamins are absorbed in the small intestine and then they are transported through the lymphatic system to be released into the bloodstream.
When the embryo reaches about 500 cells, what best describes its growth and division? A. One daughter cell is a stem cell, one is a tissue cell, they stop being smaller than the parent cell B. Both daughter cells are stem cells at this point and are smaller than the parent cell C. Both daughter cells become specialized cells, they stop being smaller than the parent cell D. One daughter cell is a stem cell, one is a specialized tissue cell, both are smaller than the parent cell
Answer:
B. Both daughter cells are stem cells at this point and are smaller than the parent cell.
Explanation:
The embryo passes through several consecutive cell divisions. With each division, the daughter cells become smaller in relation to their mother cells. In addition, these cells are embryonic and can be called pluripotent. This is because they have the ability to transform into any type of cell that the human body needs, including tissue cells.
one of the most common chromosomal disorders is ________ in which a baby has ________________.
Answer:
One of the most common chromosomal disorders is Down syndrome. Down syndrome happens when abnormal cell division results in extra genetic material from chromosome 21, too few chromosomes, or part of a chromosome may be missing. The difficulties of Down syndrome include hearing and vision weakness, weak auditory memory, fine motor skill impairment, short attention span with distractibility. Having Down syndrome can increase the risk of developing Alzheimer's disease. Having down syndrome can be associated with other health conditions such as ear infections, dental problems, endocrine problems, and seizures.
how does frshwater ecosystems help with flood conrol
Answer: In terrestrial ecosystems the presence of vegetation in floodplains and watersheds can reduce the occurrence and severity of flooding by slowing water flows, enhancing percolation and storage, and allowing gradual release of water, thereby maintaining base flows and reducing peak flows.
Explanation:
Suppose there are 70 bacteria in a Petri dish at start time. Nine hours later, there are 230 bacteria in the dish. 1.) Express the number of bacteria, P, as a function of t hours passed. Note: Round the growth rate to 4 dec. places. P(t)= 2.) Use the model from part a to determine the number of bacteria, rounded to a whole number, in the dish after 14 hours:
The number of bacteria in the dish after 14 hours, rounded to the nearest whole number, is approximately 946.
1.) To express the number of bacteria, P, as a function of time, t, we can use the exponential growth formula:
P(t) = P0 * e^(rt)
Where P0 is the initial number of bacteria, r is the growth rate, and e is the base of the natural logarithm.
Given that there are 70 bacteria initially and 230 bacteria after 9 hours, we can use these data to find the growth rate, r. Rearranging the formula:
r = ln(P(t)/P0) / t
Substituting the values:
r = ln(230/70) / 9
After performing the calculations, the growth rate is approximately 0.2275 (rounded to 4 decimal places).
Therefore, the function representing the number of bacteria, P, as a function of time, t, is:
P(t) = 70 * e^(0.2275t)
2.) To determine the number of bacteria in the dish after 14 hours using the model obtained in part 1, we substitute t = 14 into the equation:
P(14) = 70 * e^(0.2275 * 14)
P(14) = 946
Learn more about exponential growth here:
https://brainly.com/question/1596693
#SPJ11
What are three main functions of the nervous system? Give an example of each.
The nervous system is a complex network of specialized cells and tissues that is responsible for controlling and coordinating many of the body's functions.
What are three main functions of nervous system?Sensory function: Nervous system receives information from internal and external environment and processes it to generate appropriate responses. For example, when you touch a hot stove, sensory receptors in your skin detect the heat and send signal to your brain, which processes the information and generates a response to move your hand away from stove.
Integrative function: Nervous system integrates and processes information from multiple sources to generate coordinated responses. For example, when you see ball coming towards you, your nervous system integrates information from your eyes, ears, and other sensory receptors to generates response to catch the ball.
Motor function: Nervous system generates and transmits signals that control the movement of muscles and other effectors in body. For example, when you want to move your arm, motor neurons in nervous system transmit signals to the muscles in your arm, causing them to contract and move the arm.
To know more about nervous system, refer
https://brainly.com/question/869589
#SPJ1
PLEASE HELP ME !!!!!!
answer is simple diffusion
plzz mark me as a brainlist
Which statement describes the offspring of the F1 generation when crossing a pea plant that is true breeding for green seeds with a pea plant that is true breeding for yellow seeds?
The green trait is the dominant trait.
The offspring will inherit one allele from each parent.
The offspring will have both green and yellow seeds.
Each offspring will have a unique set of alleles.
Answer:
The offspring will inherit one allele from each parent
Explanation:
Just did EDGE
The statement 'the offspring will inherit one allele from each parent' describes the offspring of the F1 generation when crossing a pure green seeds pea plant with a pure yellow seed pea plant.
What is an allele?An allele is a given gene form, diploid organisms inherit two alleles for gene locus, one from each parent.
A diploid individual can be for a given gene locus:
Homo-zygousHeterozygousAn individual is homo-zygous when it inherits the same allele or gene variant for a particular gene locus.
Conversely, an individual is heterozygous when it inherits different alleles for a given gene locus.
In conclusion, the statement 'the offspring will inherit one allele from each parent' describes the offspring of the F1 generation when crossing a pure green seeds pea plant with a pure yellow seed pea plant.
Learn more about alleles here:
https://brainly.com/question/4079493
How tall is the average male in North Korea?
Answer:
The average height of men in North Korea would be 170.7 cm (5ft 7in)
Explanation:
Because they are a different breed :)