A French class has a total of 31 students. The number of males is 7 more than the number of females. How many males and how many females are in the class?

Answers

Answer 1

Answer:

12

Step-by-step explanation:


Related Questions

Can someone help me

Can someone help me

Answers

The scale factor that was used to convert triangle ABC into the image in A ' B ' C ' is 1 / 2.

How to find the scale factor ?

To find the scale factor, you need to find the length of a side of triangle ABC and then the length of the corresponding side in A ' B ' C '.

The side length we will pick is AB which is:

= 6 - 2

= 4 units

The side length of the other triangle is A' B' :

= 3 - 1

= 2 units

The scale factor is:

= 2 / 4

= 1 / 2

Find out more on scale factors at https://brainly.com/question/2826496

#SPJ1

I will give brainliest and ratings if you get this correct ​

I will give brainliest and ratings if you get this correct

Answers

Using Cramer's rule for first-order condition:

x₁ = -149/444x₂ = -69/222x₃ = 139/444

Using Hessian for the second-order condition, critical point (x₁, x₂, x₃) = (-149/444, -69/222, 139/444) is the unique minimum of y.

How to determine 1st and 2nd order condition?

(a) Using Cramer's rule for the first-order condition:

To optimize the function y, find the critical points where the gradient is equal to zero. The gradient of y is given by:

∇y = [6x₁ - x₂ - 3x₃ - 5, -x₁ + 12x₂ + 2x₃ - 4, 2x₂ + 8x₃ + 2 - 3x₁]

Setting the gradient equal to zero:

6x₁ - x₂ - 3x₃ - 5 = 0 (1)

-x₁ + 12x₂ + 2x₃ - 4 = 0 (2)

2x₂ + 8x₃ + 2 - 3x₁ = 0 (3)

Using Cramer's rule to solve this system of linear equations, the determinant of the coefficient matrix is:

|A| =

| 6 -1 -3 |

|-1 12 2 |

|-3 2 -3|

|A| = 444

The determinant of the matrix obtained by replacing the first column of A with the constants on the right-hand side of the equations is:

|A₁| =

| 5 -1 -3 |

| 0 12 2 |

| 0 2 -3|

|A₁| = -149

The determinant of the matrix obtained by replacing the second column of A with the constants is:

|A₂| =

| 6 5 -3 |

|-1 0 2 |

|-3 0 -3|

|A₂| = -138

The determinant of the matrix obtained by replacing the third column of A with the constants is:

|A₃| =

| 6 -1 5 |

|-1 12 0 |

|-3 2 2|

|A₃| = -278

Therefore, using Cramer's rule:

x₁ = |A₁|/|A| = -149/444

x₂ = |A₂|/|A| = -69/222

x₃ = |A₃|/|A| = 139/444

(b) Using the Hessian for the second-order condition:

To check whether the critical point found in part (a) is a maximum, minimum or saddle point, we need to use the Hessian matrix evaluated at the critical point. The Hessian of y is given by:

(y) =

| 6 0 -3 |

| 0 12 2 |

|-3 2 8 |

Evaluating H(y) at the critical point (x₁, x₂, x₃) = (-149/444, -69/222, 139/444):

H(y) =

| 6 0 -3 |

| 0 12 2 |

|-3 2 8 |

The eigenvalues of H(y) are 2, 6, and 18, which are all positive. Therefore, H(y) is positive definite, and the critical point is a minimum.

Therefore, the critical point (x₁, x₂, x₃) = (-149/444, -69/222, 139/444) is the unique minimum of y.

Find out more on first-order condition here: https://brainly.com/question/31451579

#SPJ1

I need help with this please help me

I need help with this please help me

Answers

Answer: 18

Step-by-step explanation:

\(\triangle HJK \cong \triangle HLK\) by HL. Therefore, \(JK=2\) by CPCTC.

Using the segment addition postulate, \(GK=9\).

Furthermore, \(\triangle HGK \cong \triangle HMK\) by HL. This means that \(MK=9\) by CPCTC.

Using the segment addition postulate again, \(GM=9+9=18\).

The entire graph of the function f is shown in the figure below.
Write the domain and range of f using interval notation.

The entire graph of the function f is shown in the figure below.Write the domain and range of f using

Answers

Domain of f is ( -4 ,1 ) and Range of f is (4 , -5)

The domain refers to the set of possible input values.

The domain of a graph consists of all the input values shown on the x-axis.

The range is the set of possible output values, which are shown on the y-axis.

According to the graph ,

The horizontal extent of the graph is starting from -4 and ending on 1

Therefore , the domain of graph is (-4 , 1)

These points are not included in the domain , you can observe the end points of curves is not filled

The vertical extent of graph is starting from 4 and going downwards till -5

so, Range of graph is (4 , -5)

To know more about Domain and Range here

https://brainly.com/question/1632425

#SPJ1

-8(6x - 7y) - (24x - 3y)

Answers

Answer:

-72x + 10y

Step-by-step explanation:

First apply the Distributive Property of Multiplication:

-8(6x - 7y) becomes -48x + 7y and -(24x - 3y) becomes -24x + 3y.

Combining like terms, we get -72x + 10y

Answer:

-21x+53y

Step-by-step explanation:

learned it


Which has a greater average rate of change over the interval where -1≤x≤3; the function
g(x)=x²+6x or the function f(x) = 2*. Provide justification for your answer.

Answers

Answer: Step-by-step explanation:

To find the average rate of change of a function over an interval, we can use the following formula:

average rate of change = (y2 - y1)/(x2 - x1)

Where x1 and x2 are the values of x at the beginning and end of the interval, and y1 and y2 are the corresponding values of the function at those points.

In this case, we are asked to compare the average rate of change of the functions g(x) and f(x) over the interval where -1≤x≤3.

For the function g(x) = x²+6x, we can plug in the given values for x1, x2, y1, and y2 to find the average rate of change:

average rate of change = (g(3) - g(-1))/(3 - (-1))

= (9 + 18 - (1 - 6))/(4)

= 27/4

= 6.75

For the function f(x) = 2, we can plug in the given values for x1, x2, y1, and y2 to find the average rate of change:

average rate of change = (f(3) - f(-1))/(3 - (-1))

= (2 - 2)/(4)

= 0

Since the average rate of change of the function g(x) is greater than the average rate of change of the function f(x), the function g(x) has a greater average rate of change over the interval where -1≤x≤3.

I hope this helps clarify the comparison of the average rate of change for these two functions. Do you have any other questions?

Andrew borrowed $700 from the bank to start a pressure washing business. The bank charged a simple interest rate of 7% per year. If it takes Andrew 3 years to pay back the loan, how much interest will he pay?

PLZ MAKE SURE IT IS RIGHT

Answers

Answer:

Simple interest=(Principal×Rate×Time)/100

Principal=$700

Rate=7%

Time=3 years

S.I.=(700×7×3)/100=147

Andrew has to pay a interest of $147.

The slope is m=2...y-intercept, b=5.
What would be the equation?

Answers

5=2x+b will be the equation because y=mx+b

What is the slope of the line whose equation is y-6=2(x+3)?

Answers

Answer:

2

Step-by-step explanation:

y=mx+n m is slope

y-6=2(x+3) so y=2x+12  m=2 is slope.

what is the best use of

Answers

Trigonometry is best used in navigation to estimate where to point the compass to get a straight line. It will be simple to pinpoint a location as well as find distance and see the horizon using a compass and trigonometric functions in navigation.

What is Trigonometry?

The area of mathematics known as trigonometry examines the correlation between the ratios of a right-angled triangle's sides to its angles. Trigonometric ratios, such as sine, cosine, tangent, cotangent, secant, and cosecant, are used to study this relationship. The concept of trigonometry was developed by the Greek mathematician Hipparchus, and the word trigonometry is a derivative of Latin from the 16th century.

One of the most significant area of mathematic is rigometry. The words "Trigonon" and "Metron," which mean respectively "triangle" and "measure," are combined to form the word "trigonometry." It is the investigation of how a right-angled triangle's sides and angles relate to one another. Therefore, using formulas and identities based on this relationship aids in determining the measure of a right-angled triangle's unknown dimensions.

Learn more about trigonometry

https://brainly.com/question/29002217

#SPJ1

Full question:

What is the best use of trigonometry?

If f(x) = Sin3x+x , verify that f(-x)=-f(x).

Answers

Answer:

True

Step-by-step explanation:

Given a function:
\(\displaystyle{f(x)=\sin 3x + x}\)

Verify that f(-x) = -f(x) by substitution -- therefore:

\(\displaystyle{f(-x) = -f(x)}\\\\\displaystyle{\sin 3\left(-x\right)+\left(-x\right) = -\left(\sin 3x + x\right)}\\\\\displaystyle{\sin \left(-3x\right) - x = -\sin 3x - x}\\\\\displaystyle{-\sin 3x - x = -\sin 3x - x}\)

Both sides are equal, hence f(-x) = -f(x).


Jessica received a $70 gift card for a coffee store. She used it in buying some coffee that cost $7.26 per pound. After buying the coffee, she had $48.22 left on her card. How many pounds of coffee did she buy?

Answers

70 - 48.22 = 21.78
7.26 x 1 = 7.26
7.26 x 2 = 14.42
7.26 x 3 = 21.78
therefore she bought 3 pounds of coffee

please help me with this

please help me with this

Answers

Answer:

30

Step-by-step explanation:

Use PEMDAS

parentheses is first

3+7=10

There's no exponents

You have to do it in order from left to right

6÷2=3

3*10=30

Answer:

The answer is 30.

First, start with 3 plus 7...that gives you 10. Then, 6 divided by 2 is 3. Lastly, multiply 10 by 3 and you've got 30!

If you can, please mark me brainliest!


Valeria operates an orange juice stand. On Monday, she used 4 1/2
Tuesday she used 3/4 as many oranges as on Monday. How many bags of oranges did Valeria use on
Tuesday?

Answers

Answer:

0.37

Step-by-step explanation:

#1
If Four cups of flour makes seven dozen holiday cookies, how many cups of flour are needed to make 126
cookies?

Answers

Answer:

6 cups to make 126 cookies

Step-by-step explanation:

dozen = 12 cookies

7 x 12= 84

126 - 84 = 42

so you will have to make 42 cookies more and that will be 2 more cups of flour

it total is 6 cups to make 126

Simplify the rational expression
7x/14x^6

Answers

The simplified form of the rational expression \((7x)/(14x^6)\) is \(1/(2x^6).\)

To simplify the rational expression \((7x)/(14x^6)\), we can begin by simplifying the numerator and denominator separately.

In the numerator, 7x, we can see that both 7 and x have a common factor of 7. So, we can rewrite the numerator as 7 × x = 7x.

In the denominator, \(14x^6\), we can see that both 14 and x^6 have a common factor of \(2x^6\).

So, we can rewrite the denominator as

\(14 \times x^6 = 2 \times 7 \times x^6 = 2 \times 7x^6.\)

Now, we can simplify the rational expression by canceling out the common factors in the numerator and denominator:

\((7x)/(14x^6) = (7x)/(2 \times 7x^6) \\= (7x)/(2 \times 7 \times x^6) \\= (cross(7x))/(2 \times cross(7) \times x^6) \\= 1/(2x^6)\)

Therefore, the simplified form of the rational expression\((7x)/(14x^6)\) is \(1/(2x^6).\)

for such more question on rational expression

https://brainly.com/question/28832980

#SPJ8

A bug ran along the number line from -5 to 23. What distance did it cover? If the whole run took the bug 4 minutes, what was its average speed?

Answers

Answer:

Distance is 28, 7 units per minute.

Step-by-step explanation:

Explanation:

6th Grade Math - Foster
223-1931-99913
Johnny works on Bob's Burger Barn and makes
$8.10 an hour. He works 9 1/2 hours each week.
He is saving his money to buy a Nintendo Switch
which costs $299.99. How many weeks must
Johnny work before he can purchase the game?
About how many hours must he work?
Dar Forter. 1247 PM
Explain your are
Due 11-59

Answers

Answer:

4 weeks

38 hours

Step-by-step explanation:

First determine how much he makes each week

8.10 * 9.5 =76.95 per week

Multiply this by w  to determine the amount he will make in w weeks

76.95w

This must be greater than or equal to the amount he needs

76.95w ≥299.99

Divide each side by 76.95

76.95w/76.95  ≥299.99/76.95

w≥3.89851

Rounding to a whole number of weeks

4 weeks

4 weeks at 9.5 hours =

4* 9.5 =38 hours

Convert 506 minutes to hours and minutes.

Answers

Answer:

8 hours and 26 minutes

Step-by-step explanation:

To convert 506 minutes to hours and minutes, we can use the fact that there are 60 minutes in one hour.

First, we can divide 506 by 60 to find the number of hours:

506 ÷ 60 = 8 with a remainder of 26

This means that 506 minutes is equal to 8 hours and 26 minutes.

Therefore, the conversion of 506 minutes to hours and minutes is:

8 hours and 26 minutes

Identify whether each function is linear or exponential.
Function A:
Function C
Function D:
You have $200 in
a savings
account that
earns 1% annual
interest
b. Which function has the greatest growth factor? Justify your response.

Identify whether each function is linear or exponential.Function A:Function CFunction D:You have $200

Answers

Answer:

A)

Function A: Exponential

Function B: Linear

Function C: Exponential

Function D: Exponential

B) Function A

Step-by-step explanation:

Function A: This is exponential because- (1, 3)(2,9)(3,27)

It is not going up by the same number each time. However, it is multiplying by 3 each time which means it is exponential.

Function B: This is linear because- (1, 64)(1, 80)(1, 96)

It is going up by 16 each time, (a constant number) which means it is linear.

Function C: This is exponential because- there is a curve, linear is always a straight line. But, this has a curve which means it is exponential.

Function D: This is exponential because- It is increasing by a percentage and not a constant number. It is increasing by 1% which means it is exponential.

The function that has the greatest growth factor is Function A because, Function A multiplies by 3 each time. Function B is linear, exponential functions always pass linear functions despite how "steep" they are. Eventually, the exponential function will surpass it. Function C is also exponential but is not as "steep" as Function A. Function A multiplies by 3 each time but Function C increases less. Function D is also exponential, and for the same reasons as Function C, Function A has the greatest growth factor.

Footlocker sold 72 pairs of the new Adidas tennis shoes for $69. How much did the store make for selling the tennis shoes?​

Answers

4,968 dollars you just have to multiply 72 x 69

Answer: $4,968

Step-by-step explanation:

Please help me in confused

Please help me in confused

Answers

Answer:

20\(c^{6}\)

Step-by-step explanation:

using the rule of exponents

\(a^{m}\) × \(a^{n}\) = \(a^{(m+n)}\)

given

(- 4c³)(- 5c³) ← remove parenthesis

= - 4 × c³ × - 5 × c³

= - 4 × - 5 × c³ × c³

= 20 × \(c^{(3+3)}\)

= 20\(c^{6}\)

if AB=x+4, BC=2x-10, and AC=2x+1, then find the value for AC.

Answers

If AB and BC are equal then AC should be 29

How did I get this?
x+4=2x-10
14=x

Plug it in
AC= 2(14)+1
AC=28+1
AC=29

KEEP IN MIND THIS WILL MOSTLY LIKELY ONLY WORK IF IT SAYS AB AND BC ARE EQUAL

After graduating from college, Trevor gets a job at a software company with a starting salary of 50,000 dollars and is given a 10% raise every year. After 10 years, what will his total earnings have been at the company? (Round to the nearest dollar)

Answers

Answer:

796871

Step-by-step explanation:

Based on the given conditions, formulate:

5000 x (1 - (1 + 10%) 10)

-------------------------------                                                                  

           1 - (1 + 10%)                                                                          

Evaluate the equation/expression:

796871.23005

Find the closest integer to

798871.23005

=  796871

A right rectangular prism is sliced perpendicular to its base.

What is the shape of the resulting two-dimensional cross section?
A- RECTANGLE
B- TRAPEZOID
C- TRIANGLE

Answers

the shape of the resulting two-dimensional cross section is  A- RECTANGLE.

Define right rectangular prism

A right rectangular prism, also known as a rectangular cuboid, is a three-dimensional geometric figure that has six faces, all of which are rectangles. The faces of a right rectangular prism are arranged in pairs such that each pair of opposite faces has the same dimensions and is parallel to the other.

The shape of the resulting two-dimensional cross section of a right rectangular prism sliced perpendicular to its base will always be a rectangle.

This is because a rectangular prism has a rectangular base and all the cross sections perpendicular to the base will have the same shape as the base, which is a rectangle.

Therefore, the correct answer is A- RECTANGLE.

To know more about cuboid, visit:

https://brainly.com/question/29568631

#SPJ1

What is The Value of X

What is The Value of X

Answers


\(\bold{ANSWER:}\)
x = 11

\(\bold{SOLUTION:}\)
What is The Value of X

Anybody know how to do this?

Anybody know how to do this?

Answers

It’s A) 81
136-55 is that

Answer:

81°

Step-by-step explanation:

So you subtract those two number to find the missing angle and get 81°.

2/15 + 1/3 and 6/7 - 1/3 Which of the two sums is closer in value to 1/2 Show your working out

Answers

Answer:

2/15+1/3

2/15+5/15

=7/15

=.46666666666666

6/7-1/3

18/21-7/21

=11/21

=.5238......

So 6/7-1/3 is closer

Step-by-step explanation:

Find the LCM of A= 3^2 x 5^4 x 7 and B= 3^4 x 5^3 x 7 x11

Answers

The LCM of A = 3² × 5⁴ × 7 and B = 3⁴ × 5³ × 7 × 11 is 3898125 using Prime factorization.

Given are two numbers which are showed in the prime factorized form.

A = 3² × 5⁴ × 7

B = 3⁴ × 5³ × 7 × 11

Prime factorization is the factorization of a number in terms of prime numbers.

In order to find the LCM of these two numbers, we have to first match the common primes and write down vertically when possible and then bring down the primes in each column.

A = 3² ×         5³ × 5 × 7

B = 3² × 3² × 5³ ×       7 × 11

Bring down the primes in each column.

LCM = 3² × 3² × 5³ × 5 × 7 × 11

        = 3898125

Hence the LCM is 3898125.

Learn more about LCM here :

https://brainly.com/question/6756370

#SPJ1

I really need help with this

I really need help with this

Answers

I am not sure I never had something like that before

Answer:

Step-by-step explanation:

Statement                     Reason

PR ≅ TR                        Given

<PQR≅<TSR                 Given

<PRQ≅<TRS                Vertical Angles Theorem

PQR=TSR                      SAS  Theorem   (Side-Angle-Side)

Other Questions
Assume that a sample is used to estimate a population mean 4. find the 99.5% confidence interval for a sample of size 704 with a mean of 31.5 and a standard deviation of 11.3. enter your answer as a tri-linear inequality accurate to 3 decimal places. Do a writing with 100 words starting with the sentence: Mum knew that I had been fighting, and wanted to know what had happened. PLS I NEED IT FOR NOW, PLS Use the map below to answer the following question: A map image showing the location of cities in modern-day Pakistan is shown. Most cities are located in the northeast of Pakistan The Indus River originates in northeast Pakistan and flows southwest toward the Arabian Sea. Feeding into the Indus River are multiple secondary rivers such as the Shalom, Chenob, and Kabul rivers. In the middle of the country is the Suleimain Mountains and in the southeast is the The Desert. In the southwest is the Dasht River, but no major city is located near this river. 2012 The Exploration Company Which statement correctly identifies the most important land feature and describes why that feature is so important to ancient human history? (1 point) 1.The frequent flooding of the Chenab River made settlement there impossible, thus forcing settlers to go back to a nomadic hunter-gatherer lifestyle. 2.The Indus River was the site for one of the earliest civilizations, without which agriculture, economy, and ancient society may have been drastically different. 3.The first boats sailed down the Indus River to reach the Arabian Sea; without it, modern sailing as we know it would not exist. 4.The Himalayan Mountains kept the people of present-day India from reaching Afghanistan. Project managers (pms) often lack the type of power that functional managers enjoy. as a pm in a weak matrix organization, what type of power must you rely on? why is assessing pain and/or distress in rats sometimes difficult? S. At Food Lion, 28 of every 35 jars of peanut butter on the shelves are creamy peanut butter. What percent of the jars of peanut butter are not creamy? write a real world deseription for the Algebraic expression 4.95x + 3 3.5-7 TCP Flow Control. True or False: with TCP flow control mechanism, where the receiver tells the sender how much free buffer space it has (and the sender always limits the amount of outstanding, unACKed, in-flight data to less than this amount), it is not possible for the sender to send more data than the receiver has room to buffer. You are walking through the jungle and you see a very large snake. Which of the following explanations best represents the James-Lange theory of emotion?You are afraid because you are shaking DNA sequence: 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 33 restriction enzymes: (| = cleavage site)Hindlil5-A|AGCTT-33-TTCGA|A-5BamHI5-G|GATCC-33-CCTAG|G-5Pstl5-CTGCA|G-3G33-G|ACGTC-5Q: If the DNA sequence is mixed with all 3 restriction enzymes, what is the digestion product sequence for both DNA strands?Show transcribed data5' CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3' Hindlil 5-A|AGCTT-3' 3'-TTCGA|A-5 BamHI 5-G|GATCC-3' 3-CCTAG|G-5 Pstl 5'-CTGCA|G-3 G3 3-G|ACGTC-5 carl has 6 he spends 3/4 of it, how much does carl spend According to the number line, what is the distance between points A and B?ABSARE+++-16-14-12-10 -8 -6 -4 -202468 10 12 14 16O 6 unitsO 7 unitsO 12 units0 14 units the king of persia who would be rich above all was: PLEASE HELP do you think we can combine a high quality of life with environmental sustainability? EXPLAIN TOO Read the following sentences and select the one that uses a homophone correctly. It is estimated that 3060 million buffalo traveled the planes in the mid-1800s in America. She preferred her hamburgers to be planeno condiments and no vegetablesjust meat and a bun. The mother and her children were the first ones on the plane; their seats were next to the cockpit. The plain was flying so low the trees were rippling after it went by. Juan carlos works 20 hours/week during the summer, 0 hours/week during the school year but saves 100% of his income. will juan carlos meet his savings goal of 4000 with this plan What might be the advantages and disadvantages of staying home to defend the knights family and estate? please SOMEONE HELP MEHHHH How to change 7.25% into a decimal? What was the outcome of John Brown's raid?Slaves gained all weapons from a Virginia arsenal.John Brown was elected as a state representative.Slaves in Virginia were granted more rights.John Brown was sentenced to hang.