The plant that colonized the coastlines of the continents that emerged after Pangea broke up about 200 million years ago is the mangrove.
Mangroves are a group of trees and shrubs that thrive in the coastal regions of tropical and subtropical areas. These plants have adapted to unique ecological conditions, including tidal fluctuations, saline soils, and waterlogged environments. As the continents drifted apart after the breakup of Pangea around 200 million years ago, new coastlines emerged, providing an opportunity for mangroves to colonize these coastal areas.
Mangroves play a vital role in coastal ecosystems, providing habitats for numerous species, protecting shorelines from erosion, and serving as nurseries for marine life. Their ability to tolerate saltwater and stabilize sediments makes them well-suited for the dynamic and challenging conditions of coastal environments that emerged following the continental breakup.
To know more about colonized , click here.
https://brainly.com/question/32059620
#SPJ4
------------The given question is incomplete, the complete question is:
"A plant that colonized the coastlines of the continents that emerged after pangea broke up about 200 million years ago is the __________."----------
Two major liberation movements marked the second half of the twentieth century. The first worked towards political, economic, religious, and ethnic independence. The second movement involved demands from which groups?
Answer: women’s rights movement
Explanation:
Reasons Why immigrants were persecuted by the Nazis?
Answer:
to get their items to increase their wealth
What role did the renaissance play in the Protestant reformation ?
Answer:
Without the Renaissance, it is difficult to imagine that the Protestant Reformation could have succeeded in Europe. The Renaissance placed human beings at the center of life and had shown that this world was not just a ‘vale of tears’ but could be meaningful, and it was possible for people to live without reference to the divine.
Explanation:
Answer:
It led to the development of a larger and more powerful Catholic Church. It encouraged people in the Church to be more spiritual. It did not play a role in religion at all.
in the gospels, the resurrection was predicted by: answers the disciples, angels, Jesus
Answer
jesus
Explanation:
THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?
The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.
Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.
The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.
To know more about nucleotide sequence visit:
https://brainly.com/question/17105264
#SPJ4
Mom the puppy ate all my socks again where does the comma go
Essay about business and labor
Answer:The goal of business’s and labor unions is to make money for itself. But how can they do that and feel like both sides have the same advantage as the other? I propose that labor and business can best achieve their goals by making compromises with each other so that they can both reach an agreement they feel is fair.
Explanation:
thats the hook
your high school diploma adds to which factor of production?
Answer:
human capital
Explanation:
The first political parties in the United States formed mainly in response to disagreements over?
taxation without representation
the doctrine of judicial review
territorial expansion to the west
the extent of federal power of the government
The first political parties in the United States formed mainly in response to disagreements over the extent of federal power of the government. The correct option is D.
A political party is an organization of people who come together to contest elections and hold power in the government. They agree on some policies and programmes for the society with a view to promoting the collective good or furthering their supporters' interests.
There were a number of political parties in the United States over time, but the first two major political parties were the Federalist Party and the Democratic-Republican Party, both of which emerged in the 1790s in response to disagreements over the extent of federal power of the government. The Federalist Party was founded by Alexander Hamilton, while the Democratic-Republican Party was founded by Thomas Jefferson and James Madison.
The Democratic-Republican Party believed in a limited federal government, while the Federalist Party believed in a strong federal government. These differing views on federal power led to a number of disagreements between the two parties on issues such as taxation, foreign policy, and the role of the federal government in the economy. These disagreements ultimately led to the formation of the first political parties in the United States.
Therefore, the correct option is D.
To know more about Federalist Party refer: https://brainly.com/question/6694881
#SPJ11
How did Imperialism, Militarism, Alliances, Capitalism and Communism play a role and affect World War 2??
Please write a paragraph on each topic. I will mark brainliest for the best answer!!
Answer:
The war started mainly because of four aspects: Militarism, Alliances, Imperialism and Nationalism. This is because big armies become potential threats to other countries, other countries started forcing alliances in order to secure land. The overall cause of World War was the assassination of Archduke Franz Ferdinand.Militarism denoted a rise in military expenditure, an increase in military and naval forces, more influence of the military men upon the policies of the civilian government, and a preference for force as a solution to problems. Militarism was one of the main causes of the First World War. These groups hoped to drive Austria-Hungary from the Balkans and establish a 'Greater Serbia', a unified state for all Slavic people. It was this pan-Slavic nationalism that inspired the assassination of Archduke Franz Ferdinand in Sarajevo in June 1914, an event that led directly to the outbreak of World War I.
The clearest and most direct example of militarism in world war 1 is the Kingdom of Romania having an army of 500,000 soldiers. So an kingdom of that size created a 500,000 man army for no actual gain.
Explanation:
What types of figurative language does Kennedy use in this speech? What effect does it
have on his speech? Why do you think he chooses to use so much figurative language?
Answer:
look at explanation
Explanation:
He uses Pathos to evoke Sympathy of the American people and parallelism in his speech to punctuate his points. he uses a lot of figurative language to connect with the audience and this results most likely in garnering their support as well as relation to them.
Write out the first six multiples of 4 and 5 in separate lists.
The lowest common multiple (LCM) is the smallest number which appears
in both lists.
What is the lowest common multiple (LCM) of 4 and 5?
Answer:
20
Explanation:
A. Wrong subject
B. 4 x 5 is 20, and if you do all the multiples before that, you would get a common one.
4 8 12 16 20
5 10 15 20
what role did the geography of the sahel play in the rise of the medieval african kingdoms? (5 points) it provided a place for trade between the north and the south. the lack of fresh water made rulers here more warlike. the desert was difficult for outsiders to invade. it provided access to the large ports on the atlantic.
It provided get entry to to the massive ports on the Atlantic.
Why is the Sahel important?The Sahel is endowed with excellent manageable for renewable electricity and sits atop some of the largest aquifers on the continent. Potentially one of the richest regions in the world with ample human, cultural and herbal resources.
What is the impact of the Sahel?The scarcity of water, pasture and fertile soil force humans to migrate. Such displacement can lead to conflicts over land and sources between herders and farmers, which in turn in addition gasoline displacement dynamics.
Learn more about Sahel here:
https://brainly.com/question/2499751#SPJ4Andrew Carnegie was employed as a clerk for a railroad company
just prior to starting his own steel manufacturing company.(1 pt)
True of False?
The given statement, "Andrew Carnegie was employed as a clerk for a railroad company just prior to starting his own steel manufacturing company." is false because it misrepresents Andrew Carnegie's career progression.
Andrew Carnegie did work for a railroad company early in his career, but he did not go directly from being a clerk for a railroad company to starting his own steel manufacturing company. After working as a telegraph operator and a railroad superintendent, Carnegie entered the steel industry by investing in and eventually establishing his own steel companies.
He founded the Carnegie Steel Company, which became one of the largest and most successful steel companies in the United States. So, while Carnegie had a connection to the railroad industry, his path to establishing a steel manufacturing company involved various stages and experiences beyond just being a clerk for a railroad company.
To know more about Andrew Carnegie , click here.
https://brainly.com/question/30358459
#SPJ4
Which Article is these consitutions from? 2nd post.. ima set it to 100 points.
example: “We the People of the United States,” , Article I—Legislative Branch
1. in Order to form a more perfect Union,
2.establish Justice,
3.insure domestic Tranquility,
4.provide for the common defence,
5. Promote the general Welfare,
6.and secure the Blessings of Liberty to ourselves and our Posterity,
7.and secure the Blessings of Liberty to ourselves and our Posterity,
The Preamble of the United States Constitution articulates the broad objectives of the government and its commitment to establishing a more perfect union, ensuring justice, domestic tranquility, common defense, general welfare, and securing liberty for the people.
The excerpt provided, "in Order to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defence, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity," is from the Preamble of the United States Constitution. The Preamble serves as an introductory statement that outlines the fundamental purposes and goals of the Constitution.
The Preamble is not specifically attributed to a particular article of the Constitution. It sets the tone and overarching principles that guide the entire document. The six goals stated in the Preamble reflect the intentions of the framers to create a strong, just, and unified nation that ensures peace, defense, welfare, and liberty for both the present and future generations.
While the Preamble does not carry legal authority on its own, it provides important context and helps to interpret the Constitution's provisions. It serves as a reminder of the aspirations and values upon which the Constitution is built.
for more questions on Constitution
https://brainly.com/question/470736
#SPJ8
which word best explains how napoleon is portrayed in this painting? heroic frightened brave weakened
The word which best explain Napoleon portrayed in the painting is Weakened.
The particular picture is of a war between Napoleon and Russia in which Russia got victory over Napoleon. In 1812, this was a turning point in the life of Napoleon and the army defeated and reduced to twenty percent of their initial capacity.
The victory made a paradigm shift and Napoleon's dream of invading Europe suffered a jolt.
On September 7, Battle of Borodino was fought just 75 miles away from Moscow, between French and Russians and losses happen at enormous on both sides. Russian withdrew and left the way open to enter Napoleon.
All the troops of Napoleon died due to starvation or the wounds from the previous war. As it was winter, French do not had any knowledge to survive with the changing weather and thus retrieve back to France.
Learn more about Napoleon, refer
https://brainly.com/question/361806
#SPJ4
in rome in the 200s C.E., how did most emperors come to power
Answer:
Heritage
Explanation:
For most of this period, emperors were not chosen on the basis of their ability or honesty, but simply because they were born in the right family.
Read the excerpt from "Lessons of Dr. Martin Luther King, Jr."
We have witnessed truckloads of grapes being dumped because no one would stop to buy them. As demand drops, so do prices and profits. The growers are under tremendous economic pressure.
We are winning, but there is still much hard work ahead of us.
The details in this passage best support the theme that
standing up for others takes courage and sacrifice.
people can make a positive change by working together.
sometimes people have to be unfair to achieve justice.
it is often difficult to take action against others.
Answer:
B. People can make a positive change by working together
Explanation:
I just took the test and got a hundred
1). Jefferson Davis second inaugural address, Jefferson Davis gave his assessment of the war and what it had accomplished. What was this assessment, and what, if anything, do you find surprising of his understanding of the Civil War?
2). In his second inaugural address, Abraham Lincoln gave his assessment of the war and what it had accomplished. What was this assessment, and how did it differ from Jefferson Davis' impression of the war?
3). According to his speech, what were Jefferson Davis' goals for the future?
4). According to his speech, what were Abraham Lincoln's goals for the future? Were his goals compatible with those of Jefferson Davis?
1) In Jefferson Davis' second inaugural address, he stated that the Confederate States had accomplished a great deal during the Civil War. 2) In contrast to Jefferson Davis' assessment, Abraham Lincoln's second inaugural address emphasized the importance of unity and reconciliation between the North and South.
1) In Jefferson Davis' second inaugural address, he stated that the Confederate States had accomplished a great deal during the Civil War. He believed that they had proven their independence and self-government, and had fought bravely for their cause. He also acknowledged the sacrifices made by the soldiers and their families, and expressed his gratitude for their dedication to the Confederacy. What I find surprising about his understanding of the war is that he seemed to overlook the fact that the Confederacy was fighting for the preservation of slavery, which was a deeply immoral and unethical institution.
2) In contrast to Jefferson Davis' assessment, Abraham Lincoln's second inaugural address emphasized the importance of unity and reconciliation between the North and South. He believed that the war had been necessary to end slavery and preserve the Union, but he also acknowledged that both sides had suffered greatly during the conflict. He called for compassion and forgiveness, and urged Americans to work together to rebuild the nation. His assessment differed from Jefferson Davis' impression in that he recognized the larger moral and political issues at stake in the war, rather than simply celebrating the bravery of the Confederate soldiers.
3) According to his speech, Jefferson Davis' goals for the future were to continue to defend the principles of the Confederacy and to secure recognition from other nations. He believed that the Confederate States had proven their ability to govern themselves, and that they deserved to be recognized as a legitimate nation by the international community. He also expressed hope that the Confederacy would be able to rebuild and thrive after the war.
4) Abraham Lincoln's goals for the future were focused on healing and rebuilding the nation after the war. He believed that the North and South needed to work together to address the challenges facing the country, and that the end of slavery represented a new era of freedom and equality for all Americans. His goals were not compatible with those of Jefferson Davis, as Davis was still committed to the preservation of the Confederacy and the institution of slavery. However, Lincoln's vision of a unified and just America has endured as a powerful symbol of hope and progress.
For more about civil war:
https://brainly.com/question/466971
#SPJ11
any sources
O secondary source
*
Timelines can show BOTH absolute and relative chronology.
False
True
Answer:True
Explanation:
what was life like for bertha adler during world war 2
Answer:
In 1944 the germans took control of liege bertha and her sisters were forced out of school. Some catholic friends of the family helped them obtain false papers and rented them a house in a near village.
Explanation:
Prohibition “rode the coattails of the Progressive Movement.” What does that mean?
Answer:
Prohibition "rode the coattails of the Progressive Movement." What does this mean? ... It overwhelmed them which made them push towards the prohibition.
Explanation:
The phrase "ride the coattails of the Progressive Movement" alludes to the notion that prohibition was permitted due to the emergence of progressive ideas in the United States.
What was Progressive Movement?
The Prohibition Movement was a political and social movement that was prominent in the United States during the Progressive Era. Their strategy was to diminish individuality while increasing government authority. One of their main worries was the difficulties produced by alcohol consumption. They believed that alcohol was the root of all poverty, disease, crime, mental illness, violence, and suffering. The 18th Amendment to the Constitution was ratified by Congress in 1918, forbidding the manufacturing, transportation, and sale of alcoholic drinks. To safeguard people and families from the "scourge of intoxication," Prohibition was instituted. However, it had unforeseen repercussions, including an increase in organized crime involved with illegal alcohol manufacture and sale, an increase in smuggling, and a decrease in tax income.
To learn more about Progressive Movement refer to: https://brainly.com/question/9369850?referrer=searchResults
#SPJ2
the significance of baybayin
Answer:
Baybayin was the form of writing used before the Spanish arrived in 1521 and missionaries had to learn it initially to spread Catholicism before forcing locals to adopt their Roman alphabet, historians say.
Historians believe the armies of the Islamic caliphates met less resistance because they:
only claimed territories when the people overthrew their own governments.
allowed conquered peoples to practice their own religions.
adopted the language and religion of each new territory.
had a larger number of soldiers than any other territory in the world.
Answer:
allowed conquered peoples to practice their own religions
Explanation:
Once stabilizing their position in the Arabian peninsula Arab Muslim forces expanded its authority into neighboring Byzantine and Sasanian empires territories. However, the success of Islamic leaders lives not only in their conquest but also in the process of stabilizing the new territories by the policy of religious tolerance. They allowed the Christian, Jews, and Zoroastrians to continues to practice their religion and it helped them to rule the conquered people easily.
Questions is attached
Answer:
A. Japan's defeat would be a turning point toward American victory in the Pacific
Explanation:
The Japanese during the Battle of Midway had lost four aircraft carriers in which the Japanese would never recover from. This had changed the tide of war and Japan was now on the defense.
Give a good thesis sentence giving the overall historical situation these words have in common. Then mention each term and define why it
is important. Tie these terms together historically in your short paragraph. Please Underline, bold or hi-light each word as you use it. (You
must use each term, have a thesis and tie the words together correctly
The Great War
Lusitania
1916 Election- He kept us out of War
Unrestricted Submarine Warfare
Zimmerman Telegram
April 2, 1917 Wilson addresses Congress
Answer:
After the assassination of Franz Ferdinand in Sarajevo on June 28th, 1914 Austria-Hungary decided to declare war on Serbia. That is how the Great War started. United States decided to stay out of war, but when Germans sunk Lusitania, a boat carried many American civilians it changed the attitude of population towards the war. Still during the campaign for the 1916 Elections a campaign for one the presidential candidates was He kept us out of War. And so it was. But when Germans continued sinking many ships and boats the Unrestricted Submarine Warfare was at the peak. United States decided to enter the war when famous Zimmerman Telegram was interrupted. On April 2, 1917 Wilson addresses Congress with words that United States have to go to war.
What was the Alamo? Why do you think it is considered the most important battle of the Texas Revolution? At the battle of San Jacinto, why did they shout “Remember the Alamo?”
Answer:
On April 21, 1836, during Texas' war for independence from Mexico, the Texas militia under Sam Houston (1793-1863) launched a surprise attack...
Explanation:
Describe the historical context surrounding the French and Indian War and Declaration of Independence And identify and explain the relationship between the events and/or ideas found
Answer:
Events Leading to the Declaration of Independence. The French and Indian War was a fight between Britain and France that lasted from 1754-1763. Because the British ended in debt, they began to demand more from the colonies. This was the first direct tax that Britain had imposed on the colonists.
Explanation:
Sry, that's all I could think of.
why did federal works agency ended
The federal works agency ended due to the fact that it was abolished by the constitution.
What was the federal works agency?Between 1939 and 1949, the Federal Works Agency, a separate department of the U.S. federal government, was in charge of enforcing a number of laws and regulations pertaining to public construction, building maintenance, and public works relief.
From 1939 until 1949, the federal government of the United States' Federal Works Agency (FWA) independently oversaw a number of public construction, building maintenance, and public works relief functions and regulations. According to restructuring plans permitted by the Reorganization Act, it was one of three catch-all federal agencies, along with the Federal Security Agency and the Federal Loan Agency.
Read more on the Federal work agency here:https://brainly.com/question/9354369
#SPJ1
2. Is Germania north or south of Italia?
Answer:
. Germany is in Western and Central Europe, bordering Denmark in the north, Poland and the Czech Republic in the east, Austria and Switzerland in the south, France and Luxembourg in the south-west, and Belgium and the Netherlands in the north-west.
Explanation:
Stay safe, stay healthy and be blessed.
Thank you