A protein is assembled amino acid-by-amino acid during the process of _______.

A. replication B. translation C. transcription D. mutation

Answers

Answer 1

Answer:

B- translation

Explanation:

Answer 2
The answer is translation

Related Questions

Which cell process is best modeled by the diagram above?

facilitated diffusion

passive transport

exocytosis

osmosis

Which cell process is best modeled by the diagram above?facilitated diffusionpassive transportexocytosisosmosis

Answers

Answer:

osmosis

Explanation:

trust me i know it

answer d osmosis

explanation

Sea water measures 5000 ml is allowed to evaporate how many parts of dissolved minerals will produce? the average salinity of ocean is 35 ppt

Answers

To determine how many parts of dissolved minerals will be produced when 5000 ml of seawater evaporates, we need to calculate the amount of dissolved minerals in that volume. When 5000 ml of seawater evaporates, it will produce 175 parts per thousand (ppt) of dissolved minerals.

The average salinity of the ocean is 35 parts per thousand (ppt), which means that for every 1000 grams of seawater, there are 35 grams of dissolved minerals. To determine how many parts of dissolved minerals will be produced when 5000 ml of seawater evaporates, we need to calculate the amount of dissolved minerals in that volume.

Since 1 ml of seawater is equivalent to 1 gram, we have 5000 grams of seawater. To find the amount of dissolved minerals, we multiply the mass of seawater (5000 grams) by the salinity (35 ppt):

Dissolved minerals = 5000 grams * 35 ppt = 175,000 parts of dissolved minerals.

Therefore, when 5000 ml of seawater evaporates, it will produce 175 parts per thousand (ppt) of dissolved minerals.

Learn more about minerals here:

https://brainly.com/question/29983937

#SPJ11

A human cell has 46 chromosomes. The cell begins mitosis and divides into two new daughter cells. How many chromosomes does each new cell contain?

Answers

The new cells has two groups of 46 chromosomes, each with their own nuclear membrane.

after a building was torn down and the area was cleared, grasses began to grow in the area. several years later, small bushes replaced the grasses. this pattern of plant growth is known as ecological

Answers

The pattern of plant growth observed after a building is torn down and the area is cleared is known as ecological succession.

Ecological succession is a process where plant and animal communities change over time in response to changing environmental conditions. In this case, the grasses that initially grew in the area were most likely pioneer species, which are the first organisms to colonize a disturbed or barren environment. As the soil conditions improved and became more suitable for plant growth, the grasses were replaced by small bushes, which are more mature and established plant species. This process of ecological succession can take many years to complete, and can result in a diverse and stable ecosystem.

The pattern of plant growth you described is known as ecological succession. Ecological succession is the process by which an ecosystem gradually changes over time. In this case, the area experienced primary succession, which occurs on a previously uninhabited site. After the building was torn down and the area cleared, grasses grew first, followed by small bushes. These stages are part of a natural process that eventually leads to a more stable, mature ecosystem, such as a forest. Each stage paves the way for the next, creating a diverse and balanced ecosystem.

To know about ecology visit:

https://brainly.com/question/30429252

#SPJ11

a new hormone has been isolated from an organism. although the structure of the hormone has not yet been determined, the hormone is known to exert its effects by forming a hormone-receptor complex that acts as a transcription factor within target cells. what type of hormone is this most likely to be? ls7c

Answers

The hormone that forms a hormone-receptor complex and acts as a transcription factor within target cells is most likely a steroid hormone.

Steroid hormones are known to bind to specific receptors within cells and form a hormone-receptor complex. This complex then acts as a transcription factor, regulating gene expression and influencing various cellular processes.

Steroid hormones are a group of hormones that the body uses as chemical messengers and are made from cholesterol. Numerous physiologic processes are governed by the steroid hormones, including the development and operation of the reproductive system.

Steroid hormone, any one of the hormones in the class of chemicals called steroids; they are discharged by three "steroid organs" — the adrenal cortex, testicles, and ovaries — and during pregnancy by the placenta. All steroid chemicals are gotten from cholesterol.

Know more about steroid hormones:

https://brainly.com/question/31922064

#SPJ11

The ______ regulates the amount of glucose circulating in the blood by either synthesizing glycogen or breaking down glycogen.

Answers

Answer:

Glucagon

Explanation:

It is a peptide hormone secreted by the pancreas, raises blood glucose levels

Glucagon stimulates glycolysis, the breakdown of glycogen and the export of glucose into the circulation

1. 0.5 points Click exactly where BamHI would cut this mutant DNA sequence. AACGGGATCCCCAATCGCATCCACCGGT. 2 0.5 points. How many DNA segments would be created by cutting this DNA with BamHr? AACGGGATCCCCAATCGCATCCACCGGT. O 3 O2 O4 O1 O0

Answers

The answer is 2. BamHI would cut the mutant DNA sequence between the 9th and 10th nucleotides, specifically between the C and the A, resulting in the following two fragments: AACGGGATC and CCCAATCGCATCCACCGGT. Cutting with BamHI would produce two DNA segments.

Cutting with BamHI would result in 2 DNA segments, one with the sequence AACGGGATCC and the other with the sequence CCAATCGCATCCACCGGT. Therefore, the answer is O2.

1. BamHI is a restriction enzyme that recognizes the DNA sequence "GGATCC" and cuts between the G and G nucleotides. In the given mutant DNA sequence, AACGGGATCCCCAATCGCATCCACCGGT, BamHI would cut at the following location: AACGGGATCC(CCAATCGCATCCACCGGT). The parentheses indicate the cut site.

2. After cutting the mutant DNA sequence with BamHI, the number of DNA segments created is 2. The sequence is split into two parts: AACGGGATCC and CCAATCGCATCCACCGGT.

To learn more about restriction enzymes please visit:

https://brainly.com/question/29882269

#SPJ11

Acid rain can have a pH between 1.5 and 5.0. The effect of acid rain on the environment depends on
me pH of the rain and the characteristics of the environment. It appears that acid rain has a negative effect
un plants. The scale below shows the pH of normal rain.
Normal
rain
1 2 3 4 5 6 7 8 9 1011121314
PH Scalo
Provide the information requested In questions 41-43 that should be included in a research plan to test the
effect of
pH on the early growth of bean plants in the laboratory.

Q: State a hypothesis, identify the independent variable and state 2 factors that should be kept constant

Answers

Answer:

what effects do the pH has on different conditions of weather

Explanation:

ketp constant is the temperature....independent variable is time

Acid rain can have a pH between 1.5 and 5.0. The effect of acid rain on the environment depends on the pH of the rain and the characteristics of the environment. It appears that acid rain has a negative effect on plants.

Can acid rain hurt you?

Acid rain does not directly harm the human body, but the resulting sulfur dioxide can cause health problems. In particular, sulfur dioxide particles in the air can promote chronic lung problems such as asthma and bronchitis.

Acid rain or acid deposit is a broad term that includes all forms of precipitation, including acidic components such as sulfuric acid and nitric acid, falling from the atmosphere into the ground in a moist or dry form. This can be rain, snow, fog, hail, and even acidic dust.

Learn more about Acid rain here: https://brainly.com/question/6700006

#SPJ2

Which of the following could occur for Iceland if there were no surface currents?
a. Iceland does not exist
b. Iceland would become a desert
c. Iceland's climate would not change.
d. Iceland's climate would change​

Answers

Iceland does not exist

Sam has a mutation in a gene that affects the function of a transfer RNA (tRNA). Human cells have 20 different types of tRNAs, and each adds a different amino acid to growing peptide chains, which form proteins. Based on what you know so far, would you expect this mutation to affect all proteins produced in Sam's cells? Explain your reasoning.

Answers

Answer:

No

Explanation:

The mutation is not expected to affect all the proteins produced in Sam's cells because each protein has a different structure and functions. Proteins are polymers of amino acids and the component amino acid for each protein diffesr. Hence only the proteins whose constituent amino acids include the amino acid being carried by the mutated tRNA would be affected. Others whose constituent amino acids do not include the amino acid being carried by the mutated tRNA would function normally.

Peas (case study 28) by Stuart Chambers and Tammy Helander

1.What are the capacities at each main stage of the pea processing?

2 Which is the bottleneck process, and how is this managed to maximise throughput?

3 (a) What is the design capacity of the overall operation?

(b) What is the effective capacity?

(c) Calculate the efficiency and utilisation for the operation over the current

year’s pea season. Would this give a good indication of the factory performance, for example in benchmarking against other factories in the group, such

as frozen pizza manufacturing?

4 Prepare graphs showing:

(a) the daily output compared to design and effective capacity

(b) cumulative output compared to cumulative design and effective capacity

What do these tell us about the operation?

5 Summarise the reasons why capacity is lost on some days in mid-season.

What could be done to reduce this problem?

6 Do you think that John Lincoln’s desire to extend the pea harvest period is the

best strategy for the overall operation?

Answers

John Lincoln’s desire to extend the pea harvest period is not the best strategy for the overall operation as it will lead to increased costs and a lower quality product.

Capacities at each main stage of the pea processing are as follows:

Infeed: 9000 kg/hr

De-stoning: 2000 kg/hr

Blanching: 2000 kg/hr

Cooling: 2000 kg/hr

Drying: 2500 kg/hr

Sorting and grading: 2000 kg/hr

Packaging: 2000 kg/hr

The bottleneck process is the drying stage and is managed by adding two drying silos.

The design capacity of the overall operation is 2000 kg/hr x 24 hrs = 48,000 kg/day.

The effective capacity = total weight of peas processed during the season / total number of days in the season. Effective capacity = 2,072,000 kg / 93 days = 22,301.08 kg/day.

Efficiency = (actual output / standard output) x 100% = 2072000 kg / 2305200 kg x 100% = 89.93%.Utilisation = (actual output / design capacity) x 100% = 2072000 kg / 2304000 kg x 100% = 89.94%.

The efficiency and utilization of the operation over the current year’s pea season give a good indication of the factory's performance, which is important for benchmarking against other factories in the group.

Graphs showing the daily output compared to design and effective capacity. b. Graphs showing the cumulative output compared to cumulative design and effective capacity. These graphs tell us how much output is being produced by the factory over time, and how it compares to the design and effective capacity.

Capacity is lost on some days in the mid-season due to various reasons such as poor weather conditions, mechanical problems, and quality issues. To reduce this problem, the factory can take several measures, such as maintaining equipment, improving quality control, and increasing storage capacity.

John Lincoln’s desire to extend the pea harvest period is not the best strategy for the overall operation as it will lead to increased costs and a lower-quality product. Instead, the factory should focus on improving efficiency and utilization to maximize output while maintaining quality.

To learn more about costs, visit:

https://brainly.com/question/17120857

#SPJ11

what do you understanding about biology

Answers

Answer:

The study of all life or living matter is biology.

Answer:

Biology is the study of life. In general, biologists study the structure, function, growth, origin, evolution and distribution of living organisms. Biology is important because it helps us understand how living things work and how they function and interact on multiple levels.

Explanation:

I hope this helps!

Can I have brainliest?

Also can you please thank me? :)

Explanation photosynthesis and give an example

Answers

Answer:

Flower takes sunlight and turns it into energy

Explanation:

When a flower takes sunlight and turns it into food for the plant

Answer:

Photosynthesis is the process is which plants and other organisms transform light energy into chemical energy.

Explanation:

Example :

How plants convert energy from water, air, and sunlight into energy to grow. The water from the plants leaves evaporates through the stomata, and taking its place, is carbon dioxide. Which is what plants need to make food.

dna sequences that are binding sites for transcription factors are called

Answers

The DNA sequences that are binding sites for transcription factors are called origin of transcription.

DNA binding sites found in DNA where other molecules may bind. DNA binding site are part of DNA sequences (genome) and are bounded by DNA-binding proteins. The sum of DNA binding site of a specific transcription factor is referred to as cistron.

Transcription factors are protein that bind to DNA sequences to regulate gene transcription. These proteins bind to the DNA of promoter or enhancer regions of specific genes.

Specific transcription factors are important in initiating patterns of gene expression that result in developmental changes. Many transcription factors are common to several cell types such as AP-1 and play general role in regulation of inflammatory genes.

Transcription factor that bind to cis-regulator DNA sequences are responsible for either positively or negatively influencing the transcription of specific genes and determining whether that particular gene will be "on" or "off".

To know more about transcription,

https://brainly.com/question/1246654

The DNA sequences that are binding sites for transcription factors are called Response Elements (REs). The binding sites for transcription factors are called Response Elements (REs).

DNA sequences that are binding sites for transcription factors are called Response Elements (REs). These sites, which are usually located in the promoter region of the gene, regulate gene expression by interacting with transcription factors. Transcription factors are proteins that bind to DNA and regulate the transcription of genes.

They are necessary for the initiation and regulation of gene expression. REs play a crucial role in gene regulation, as they help to turn on or off gene expression. When transcription factors bind to REs, they either activate or repress transcription, depending on the nature of the factors involved. The specificity of this interaction is important, as different transcription factors bind to different REs, allowing for precise regulation of gene expression.

Overall, REs are critical components of gene regulation, as they help to control the expression of genes in response to different signals and environmental cues.

Learn more about transcription here:

https://brainly.com/question/6604811

#SPJ11

whether falling dominoes form a wave and how do you now ​

Answers

The wood does not move in the same direction as the wave is moving, but rather it moves in a direction perpendicular to the travel of the wave, i.e. transverse. In the case of the falling dominoes, the movement of the dominoes was in the direction parallel to the movement of the wave, i.e. longitudinal.

1. fatty acids2. amino acids3. phospholipids4. hydrogen5. peptide6. tertiary7. secondary8. rough endoplasmic reticulum9. ribosome10. Golgi apparatus11. vesicle

1. fatty acids2. amino acids3. phospholipids4. hydrogen5. peptide6. tertiary7. secondary8. rough endoplasmic

Answers

The production of antibodies inside the lymphocytes starts at the ribosome (organelle) by joining amino acids together, creating peptide bonds, and forming the primary level structure polypeptide. The polypeptide bends and folds tertiary in the Golgi apparatus (organelle), to form the next level of structure. For instance, the secondary level of structure is formed by hydrogen bonds to create alpha helix or beta-pleated formations.

In order for an antibody to be released into the blood, a fully formed antibody will move from rough endoplasmic reticulum (organelle) to another organelle named Golgi apparatus to sort and be processed for shipment out of the cell. Antibodies transport from organelle to organelle and to the plasma membrane in a vesicle, which is made out of fatty acids-phospholipids.

1. fatty acids

2. amino acids

3. phospholipids

4. hydrogen

5. peptide

6. tertiary

7. secondary

8. rough endoplasmic reticulum (organelle)

9. ribosome (organelle)

10. Golgi apparatus (organelle)

11. vesicle

The act of getting bigger or the body changing

Answers

Answer:

Puberty

Explanation:

Puberty
Changes the body

The mean diviion time for bacteria population C i 20 minute. Calculate how many bacteria will be preent after 4 hour, when tarting with 50 bacteria

Answers

The mean division time for bacteria population C is 20 minute. Calculate how many bacteria will be present after 4 hour, when tarring with 50 bacteria is 2 hours.

The amount of time a bacterium needs to multiply twofold in a given amount of time is known as its generation time. Depending on the organism, this generation time can change.One E. coli bacteria is known to be produced every 20 minutes on average. Therefore, the E. coli bacteria can multiply by two in just 20 minutes. If there are originally 50 cells present in the culture medium, the E coli bacteria will multiply by completing 6 generations in 2 hours and increasing in number to 3200.

Learn more about bacteria

brainly.com/question/8008968

#SPJ4

in some fungi and slime molds, mitosis may occur without cytokinesis. what would you expect to find in these species?

Answers

In some fungi and slime molds, mitosis may occur without cytokinesis , Cells that contain multiple nuclei would you expect to find in these species So the correct option is B

Without cytokinesis, mitosis produces a cell with multiple nuclei but a linked cytoplasm (syncytium). A cell containing several nuclei is said to be multinucleated. This may be a frequent occurrence. The cytoplasm would not be split and there would not be two identical daughter cells if cytokinesis did not take place during mitosis. Thus, the cell wouldn't be able to divide into two different cells and would continue to stay at rest.

Learn more about mitosis,

https://brainly.com/question/29776367

#SPJ4

Full Question ;

In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species.

a. Cells that don't contain nuclei.

b. Cells that contain multiple nuclei.

c. DNA that never condense into visible chromosomes.

d. Nuclei that never enter interphase.

True or false: Proteins provide hormones

Answers

Answer:

false

proteins dont provide hormones

The answer is : FALSE

Which of the following is not generally true of k-selected species compared to r-selectedspecies?
A. They have shorter generation times.
B. They reach sexual maturity later.
C. They have fewer young.
D. They have longer life spans.
E. They have slower population growth rates

Answers

They have shorter generation times than the r selected species, which is the correct response (A).

Through the colonization-competition trade-off, R- and K-selection limit the range of viable species, with strong r-selection favouring colonisers and strong K-selection favouring competitors. However, the degree of disturbance also influences the success of species. R selection has a greater number of offspring and a shorter lifespan compared to K selection, which has fewer offspring and a longer lifespan. Long gestation periods of several months, slow maturation (and consequently prolonged parental care), and long life spans are traits of K-selected species.

To learn more about species click here:

https://brainly.com/question/1165742

#SPJ4

Protons have a positive charge, electrons have a negative charge, and neutrons have no change. Given
information, if an atom is comprised of 5 protons, 4 electrons, and 5 neutrons, what is the charge (if any)
on this molecule?
A.It does not have a charge because there are equal amounts of neutrons and protons
It needs to lose a neutron and a proton so that all parts of the atom are equal
It has a positive charge because there are more protons than electrons
It has a negative charge because there are more neutrons and electrons than protons

Answers

B it needs to lose a neutron and a proton so that all parts of the atom are equal

Rachel has severe pain in the upper right abdomen area. This is a symptom of which of the following?
-Cirrhosis
-Dyspepsia
-Cholecystitis
-PUD

Answers

Severe pain in the upper right abdomen area is a symptom of Cholecystitis.

Cholecystitis is the inflammation of the gallbladder. The gallbladder is a sac-like organ situated in the upper right abdomen, beneath the liver. It stores bile that is produced in the liver and aids in digestion. Cholecystitis is typically caused by the presence of gallstones, which may obstruct the cystic duct, resulting in inflammation of the gallbladder.Signs and SymptomsThe following are some common symptoms of Cholecystitis:Severe pain in the upper right abdomen area that lasts for several hours.Pain that radiates from the upper right abdomen to the shoulder blade or back.Pain that worsens when taking deep breaths.Nausea and vomiting.Fever.DiagnosisA physical exam, an ultrasound, a CT scan, and blood tests are all used to diagnose Cholecystitis. Treatment:Cholecystectomy (gallbladder removal) is the most common treatment for Cholecystitis. Antibiotics are given to treat the infection. Pain medication may be prescribed to relieve severe pain.

learn more about Cholecystitis Refer: https://brainly.com/question/31567928

#SPJ11

How does virus and bacterial infections each affect healthy body cells?

Answers

The virus infections happens when a virus gets past the physical barriers of the body (skin, mucus, and so on) and infect a suitable cell, the virus take the genetic machinery of the host cell to replicate, damaging that cell and making more virus that will do the same process with other suitable cells. After the virus use all the cell potential, it will kill the cell and release all the virus that were in the cytoplasm of the host. While bacterial infections have more autonomy, being not necessary the integral machinery of the cell to multiply in the host body, it can act in differrebt ways, such as: crowd out the host tissue and disrupt the function, killing the cells or tissues outright, destroy the metabolic machinery, cause a massive toxic reaction in the immune system, and release toxins that can make the body stop all their functions at once (paralyze the metabolic and general system of the host).

Which option is not a response to internal stimuli?.

Answers

Internal stimuli are biological responses of the human body to its own physical conditions. The human body is perpetually in a state of homeostasis, and physiological systems are continuously adjusting to maintain this balance. Internal stimuli include hunger, thirst, and changes in blood pressure, heart rate, and body temperature.

In response to these stimuli, the body reacts to restore balance.When it comes to internal stimuli, "tasting something sweet" is not an appropriate response. Tasting something sweet is a response to external stimuli. When you put something sweet in your mouth, your taste buds send a message to the brain, which perceives the sweet taste. This perception triggers a series of physiological responses, including the release of insulin to process the sugar in the food.Internal stimuli, on the other hand, are the responses to changes in bodily functions or to changes in the environment of the body.

These include hunger, thirst, and changes in blood pressure, heart rate, and body temperature. In response to these stimuli, the body reacts to restore balance. These responses can include changes in heart rate, breathing rate, sweating, or shivering.

To know more about Internal stimuli visit:-

https://brainly.com/question/11557304

#SPJ11

PLEASE HELP WILL GIVE BRAINLIEST

PLEASE HELP WILL GIVE BRAINLIEST

Answers

Answer:

Al

Explanation:

To survive, plants and animals carry out cellular respiration to break down sugar in the presence of oxygen to release energy in form of ATP. But they also use photosynthesis to make their own food.

Which term names the threadlike body that makes up many fungi?

Responses

flagella

mycelia

cilia

spore bodies

Answers

Answer:

MYCELIUM/MYCELIA

Explanation:

thats just the correct answer, no doubt, no scam, i searched it to make sure. MARK AS BRAINLIEST PLSSSS

Mycelia is the correct answer

7. An extremely rare X-linked recessive genetic disorder known as Norrie disease affects the eyes
and can lead to blindness and in some cases hearing loss. There are only 400 known cases of
Norrie disease worldwide. Explain why it is virtually impossible for a baby girl to be born with
Norrie disease.

Answers

Answer: Girls need to inherit two affected chromosomes to develop the disease, and it may also happen that the affected chromosome is inactivated in the eye (if it has only one)

Explanation:

Norrie's disease is an inherited eye disorder affecting males, which is characterized by abnormal or immature development of the retina (light-sensitive nerve tissue lining the back of the eye) and possible deterioration of the iris (colored part of the eye) and eyeballs. X-linked recessive inheritance is one of the ways in which a genetic trait or condition is passed from parent to child when there are mutations in a gene on the X chromosome from either the father or the mother. Females possess two X chromosomes, while males possess one X and one Y chromosome. In males, the presence of a mutation on the X chromosome causes the disease, since it is the only X they possess. In females, both X chromosomes need to be affected if it is a recessive condition.

So, the disease is inherited in an X-linked recessive manner, which means that almost all affected individuals are male. However, the sons of affected males will not have the mutation since they only inherit the Y chromosome, while all their daughters will be genetic carriers of the mutation because they inherit the affected X chromosome, although without clinical symptoms but being carriers. On the other hand, the mother will pass one of her two X chromosomes (which may or may not be affected) randomly to both her male and female offspring (if they are male, they will be affected and if they are female they will be carriers unless they also inherit an X chromosome from their father). So the only way for females to develop the disease is for their two copies of the gene to be mutated if both parents have the mutation.

But female carriers could be affected by inactivation of their X chromosome with the correct sequence. X chromosome inactivation is a random process that happens separately in individual cells during embryonic development. That is, one cell may inactivate the paternal X chromosome, while others may inactivate the maternal X chromosome. This is because a dosage compensation is necessary, since the Y chromosome in males is not homologous to the X, it does not have the same genes, so if females would express both X chromosomes, they would have twice as many genes as a male.  All the descendant cells of each of these original cells will maintain the same pattern of X chromosome inactivation.

In females, one X chromosome is inactivated in each tissue in an arbitrary manner. Then, in addition to having to inherit two affected chromosomes, it may also happen that the affected chromosome is inactivated in the eye (if it has only one).

Which sphere is oxygen in our blood part of?

Lithosphere

Biosphere

Mesosphere

Atmosphere

Answers

Answer:

The biosphere is the sphere that oxygen in our blood is part of.

Question 2 of 10
Which of the following is a description of a resource that belongs to a country
with a high carrying capacity?
A. Homes are small and house many people.
O B. Food is brought in from other places.
C. Water comes directly from bodies of water.
OD. Food is not always available.
SUBMIT

Answers

Answer:

c

Explanation:

cause it comes straight from the creek behind the houses

Carrying capacity defines the population size supported by a region. Water coming directly from water bodies suggests a high carrying capacity. Thus, option C is correct.

What is carrying capacity?

Carrying capacity is the quantity of the organisms or the population that can be supported in a habitat without any degradation and damage to the environment. It is a crucial factor in ecology.

It can be high and low depending on the availability of water, food, and space. A high carrying capacity can support a large population than a low carrying capacity because of the abundant resources.

Small homes with large family members, imported food items, and scarcity of food are limiting factors that are not the property of the high carrying capacity, instead, abundant availability of water is the characteristic of the high carrying capacity.

Learn more about carrying capacity here:

https://brainly.com/question/2243548

#SPJ5

Other Questions
West African dance influenced __________, a martial art dance form popular in Brazil. A. Capoeira B. Kente C. Souks D. Casbah Please select the best answer from the choices provided. A B C D. The Widgetville County Wolfpack has won 90 percent of their last 20 games played under a full moon. What does this imply Universal healthcare pros and cons- is it a human right? Find the polynomial function in standard form that has the zeros listed. i and -i What happens in chapter 17 of Huckleberry Finn? on a girls volleyball team 9 out of 12 team members have played in previous years based on this information if 80 girls are in a volleyball league than how many could be expected to have played the year before? in national income accounts, what does value added refer to? multiple choice question. the value of all the inputs used by the final producer the difference in the market value and cost of inputs purchased from other firms the cost of inputs at the first stage of production the value added to the production process by labor only Why did Lee go on the offensive against the North? Where racial and ethnic consciousness is strong, people tend to see their own racial or ethnic group as superior to others. this reflects quilet? Which of the following is NOT true concerning herbal supplements?a. Examples include echinacea, St. John's wort, ginseng, and ginkgo.b. Herbal supplements can have drug-like effects.c. Herbal supplements can contain toxins.d. Herbal supplements have a Recommended Dietary Allowance (RDA) associated with them.e. Herbal supplements can be dried preparations of flowers, leaves, bark, roots or seeds. Ariana rode A bicycle 7 miles and 42 minutes. Abelito road his skateboard 8 miles in 48 minutes. Who traveled at a greater average speed? Define an appropriate unit of speed and provide mathematical justification for your answer. Please i need this by TONIGHT!! a __________ is the maximum amount of time that a process can execute before being interrupted. a nurse in community health conducts quarterly mental health-promotion and depression-screening programs at the local senior center. the nurse is aware that older adults are at increased risk for developing depression. using such an intervention also addresses the older adults': Parabolic solar collectors used to supply heat for a basic absorption Lithium Bromide - water refrigeration system works with temperatures 76 C, 31 C, 6 C and 29 C for generator, condenser, evaporator and the absorber vessel respectively. The heat generated from the collectors is about 9000 W. If each 1 kW refrigeration needs about 1.5 kW heat find;1) Refrigerant flow rate? 2) The mass flow rate for both strong and weak solutions? 3) Check you solution? The FCC recommends that firms conduct market __________t , Incorrect Unavailable to eliminate possible bias related to judgments about some population segments as they identify their target audience for advertising.executingevaluatingresearch Please help me I've been stuck on this for hours at this point don't bother providing an explanation I need answers given an ordered array with 15 elements, how many elements must be visited in the worst case of binary search? group of answer choices 3 4 2 8 in dna transformation less farmful bacteria becvame harmful throuyg mutation oin ratsT/F express 2342 base five in base 10 suppose you are teaching a science course and have prepared a demonstration to teach how a thermometer works. when you plunge the thermometer into hot water, one of your students points out that the mercury in the thermometer actually went down a little bit before it shot up. it behaved in such a way because