An engineer is building a new steel skyscraper in a area with a lot of Earthquakes, Compare two systems (fixed based system and base isolated system) and choose which one would be better.

Answers

Answer 1

Answer:

Base isolated system

Explanation:

Fixed based system:-

A fixed-base building (built directly on the ground) will move with an earthquake’s motion and can sustain extensive damage as a result. 

Base isolated system:-

A base isolation system is a method of seismic protection where the structure (superstructure) is separated from the base (foundation or substructure).

Hence,

A base isolated system is much more better in a area where there are a lot of earthquakes.


Related Questions

what is biodiversity Which of the following shows the correct chronological order (geologically oldest to most recent) of near or total extinctions for the organisms listed?

Answers

Answer:

Biodiversity is the diversity of living beings, be they animals or plants, which together make up the totality of life on planet Earth.  In other words, the term biodiversity necessarily implies a large number of different species and genres of living beings, which interrelate with each other through food chains, sharing natural habitats or even establishing more complex links. In any case, it requires that heterogeneity that implies the existence of several different living beings from each other in a given space.

5 reasons why lysosomes are also referred to as suicidal bags

Answers

Answer:

i dont know search google

In a dihybrid cross between two pea plants, one parent is green pod-purple flower (GgPp). The other parent’s genotype is unknown. The phenotype f ratio of their offspring is (1 Green Pod-Purple Flower : 1 Yellow Pod-Purple Flower). What is the genotype of the unknown parent?

Answers

The unknown parent's genotype in the dihybrid cross is likely GgPp. This genotype would result in a 1:1 phenotypic ratio of green pod-purple flower to yellow pod-purple flower offspring.

In a dihybrid cross, we consider two independent traits. In this case, the traits are pod color (green or yellow) and flower color (purple). The known parent's genotype is GgPp, where G represents the dominant allele for green pod color, g represents the recessive allele for yellow pod color, P represents the dominant allele for purple flower color, and p represents the recessive allele for non-purple (white) flower color.

Since the phenotypic ratio of the offspring is 1 green pod-purple flower : 1 yellow pod-purple flower, we can infer the possible genotypes of the unknown parent. The observed phenotypic ratio suggests that both parents contribute equally to the offspring's traits. Therefore, the unknown parent likely carries the same genotype, GgPp.When the unknown parent's genotype is GgPp, it means that it can produce two types of gametes: GP and gP. The known parent, GgPp, can also produce two types of gametes: GP and gP. The cross between these parents can result in four possible genotypes for the offspring: GGPp, GgPp, Ggpp, and ggPp. However, only two of these genotypes correspond to the observed phenotypic ratio: GgPp (green pod-purple flower) and ggPp (yellow pod-purple flower).

Therefore, the genotype of the unknown parent is likely GgPp, which produces the desired 1:1 phenotypic ratio of green pod-purple flower to yellow pod-purple flower in the offspring.

For more questions on genotype

https://brainly.com/question/27993582

#SPJ8

if 4 molecules of water are oxidized by the light-dependent reactions, how many molecules of ATP are formed directly as a result?

Answers

When 4 molecules of water are oxidized by the light-dependent reactions, six molecules of ATP are formed directly as a result.

What are molecules?

A molecule is described as a group of two or more atoms held together by attractive forces known as chemical bonds.

The Adenosine triphosphate (ATP) is described as the source of energy for use and storage at the cellular level. The structure of ATP is a nucleoside triphosphate, consisting of a nitrogenous base (adenine), a ribose sugar, and three serially bonded phosphate groups.

During the  light-dependent reaction the ions flow through ATP synthase from the thylakoid space into the stroma in a process called chemiosmosis to form molecules of ATP.

Learn more about molecules at:  https://brainly.com/question/13348791

#SPJ1

Which element us considered the most versatile element in living organisms and why?

Answers

Answer:

Carbon, because it provides strength to the important protein, keratin. So, Carbon is considered the most versatile element in living organisms.

Explanation:

The answer is Carbon

Storing water in dams, forecasting rainfall, and getting insurance on surrounding areas are all factors of:
A. implementing the Clean Water Act.
B. All of these
C. managing river floodings.
D. managing the hypoxic zone of the Gulf of Mexico.

Answers

i think c but i could be wrong

Which of the following resources has the advantages of being a very predictable energy source and renewable?

Answers

A: nuclear power

B: Ocean Exothermic energy

C:petroleum energy

D: tidal power:

A duplicated homologous chromosome pair contains how many copies of genes ?

A.) 2
B.) 4
C.) 8
D.) 16
E.) 32

Answers

A duplicated homologous chromosome pair contains 4 copies of genes because each chromosome has two copies of gene.

How many copies of gene present in a chromosome?

The two homologous copies of gene present in each chromosome so for the two chromosomes, four genes copies are present.

So we can conclude that a duplicated homologous chromosome pair contains 4 copies of genes because each chromosome has two copies of gene.

Learn more about chromosome here: https://brainly.com/question/269366

________ is a product of the Calvin Cycle that is used to form glucose phosphate, amino acids or fatty acids.
A. PEP carboxylase (PEPcase)
B. carbon dioxide
C. glyceraldehyde-3-phospate (G3P)
ATP
D. ribulose bisphosphate (RuBP)

Answers

Answer:

option C is correct that is glyceraldehyde-3-phosphate

Explanation:

Answer:

i would say c, got it right on ed2020

Explanation:

Which organisms were the first to perform photosynthesis on the earth

Answers

Answer:

cyanobacteria

Explanation:

After inoculating and incubating an agar slant from a pure broth culture of the bacterial species Serratia marcescens, which of the following would indicate an unsuccessful aseptic transfer? Select all that apply. There is fungal growth in the original broth culture tube. There are red, yellow, and white colonies on the slant. There is no growth on the slant. There are colonies of the same morphology on the slant.

Answers

Answer:

there is no growth on the slant

Which is a biotic factor?

Answers

Answer:

a living organism that shapes its environment

Explanation:

hope this helps

Why is there less air pressure at higher altitude?
A: Air at higher altitudes doesn't have as much air weighing down on it from above.

B: Air at higher altitudes is cooler and less turbulent.

C: The warmer, lighter air rises bringing cooler heaver air to low altitudes.

D: The molecules in the air lose mass and are less effected by gravity, significantly lowering their weight.

Answers

I believe D is the answer to the question
Hope this helps you have a good night

There less air pressure at higher altitude because the molecules in the air lose mass and are less effected by gravity, significantly lowering their weight. Thus, option D is correct.

What is the mass percent?

Mass percent is the mass of the element divided by the mass of the compound or solute.

Step 1: Calculate the mass of the compound.

mCH₄O = 1 mC + 4 mH + 1 mO = 1 (12.01 amu) + 4 (1.00 amu) + 1 (16.00 amu) = 32.01 amu

Step 2: Calculate the mass of hydrogen in the compound.

mH in mCH₄O = 4 mH = 4 (1.00 amu) = 4.00 amu

Step 3: Calculate the mass percent of hydrogen in the compound.

%H = (mH in mCH₄O / mCH₄O) × 100%

%H = 4.00 amu / 32.01 amu × 100% = 12.5%

The mass percent of hydrogen in CH₄O is 12.5%.

CO2 = 1.580 grams H2O = 0.592 grams Lookup the molar mass of each element in the compound Carbon = 12.0107 Hydrogen = 1.00794 Oxygen = 15.999 Calculate the molar mass of CH4O by adding the total masses of each element used. 12.0107 + 4 * 1.00794 + 15.999 = 32.04146 Now calculate how many moles of CH4O you have by dividing by the molar mass.

Therefore, There less air pressure at higher altitude because the molecules in the air lose mass and are less effected by gravity, significantly lowering their weight. Thus, option D is correct.

Learn more about mass percent here:

https://brainly.com/question/5295222

#SPJ5

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

how do they measure global climate change ​

Answers

Answer:

Hello There!!

Explanation:

The answer is=>It is mosly measured using the average surface temperature if the planet/Earth.

hope this helps,have a great day!!

~Pinky~

\(\huge{\textbf{\textsf{{\color{navy}{An}}{\purple{sw}}{\pink{er}} {\color{pink}{:}}}}}\)

Climate change is most commonly measured using the average surface temperature of the planet.

ThanksHope it helps.

The factor in the environment that does NOT depend on the number of members per unit area?

1) Predation
2) Competition
3) Pollution

PLEASE PLEASE

Answers

I’m pretty sure that it’s 3) Pollution

Related to weather what does 0% cloud cover mean?

Answers

Answer: 0% cloud coverage means there are no clouds in the sky and it is a clear day.

Explanation: Cloud cover mean how much cloud coverage and 0% means nothing at all is covered.

_________ is a form of spina bifida in which a saclike cyst filled with CSF protrudes through the spinal defect but does not involve the spinal cord. a. Meningomyelocele b. Meningocele c. Myelomeningocele d. Spina bifida occulta

Answers

Answer:

b. Meningocele

Explanation:

Meningocele is a congenital deformity where there is a sac protruding from the spinal column, which is not related to acute neurological conditions. Thus, meningocele is caused by a protrusion of the meninges (i.e., membranes that envelop the brain and spinal cord) and cerebrospinal fluid but without accompanying nervous tissue. About 1,500 babies each year born with this type of spinal birth defect. Moreover, spina bifida occulta is a mild type of spina bifida caused when one or more vertebrae do not fully form during pregnancy. Finally, meningomyelocele (also known as myelomeningocele) is a severe type of spina bifida caused when the spinal cord and nerves develop outside of the body.

Answer:

b. Meningocele

Explanation:

Meningocele is a form of spina bifida in which a saclike cyst filled with CSF protrudes through the spinal defect but does not involve the spinal cord.

a distance method for reconstructing phylogenies that identifies the tree topology with the shortest possible branch lengths given the data is

Answers

A distance method for reconstructing phylogenies that identifies the topology of the tree with the shortest possible branch lengths given the data is known as: neighbor joining.

Phylogeny is the branch of biological sciences that deals with the evolution of organisms, their history and relationship with other organisms. The study focuses upon the heritable traits, DNA sequences, protein morphology, etc.

Neighbor joining in phylogeny is the method that establishes connection between distantly related organism  by the shortest way possible while constructing a phylogenetic tree. The relationship is based on DNA or protein sequences. The method was given by Saitou and Nei.

To know more about phylogeny, here

brainly.com/question/14124290

#SPJ4

What are the four types of final impression material? Of the four, which one is the seems to be the least desirable to use, based on what you have read about each of the four types.

Answers

The four types of final impression materials are: 1) inelastic impression materials, 2) elastomeric impression materials, 3) hydrocolloid impression materials, and 4) inorganic impression materials.

Inelastic impression materials, which include plaster and compound materials, seem to be the least desirable to use as final impression materials. These materials are rigid and lack flexibility, which makes it difficult to obtain accurate impressions of complex oral structures, and they can also cause discomfort for patients during the impression process.

Elastomeric impression materials, hydrocolloid impression materials, and inorganic impression materials have largely replaced inelastic materials due to their improved accuracy and ease of use.

To learn more about inelastic follow the link:

https://brainly.com/question/31356190

#SPJ1

As a persons ages his or her bones tend to become brittle. This happens as ______ is lost from bone
A.Protein
B.Iron
C.Marrow
D.Calcium

Answers

Answer:

D

Explanation: the bones can becomew brittle from not haveing calcium

How does an increase in atmospheric carbon dioxide effect the oceans?
Choose all that apply
-It causes them to dry-up and shrink in size.
-It causes sea levels to rise.
-It causes them to be more acidic.
-it causes them to be warmer.

Answers

Explanation:

Definitely global warming is correct because global warming is a slow process, a few degrees in hundreds of years. Moreover, there are multiple sources (causes) responsible for Earth warming. Though the Earth warms up very slowly (incomparably slower than heating a pot of water on the stove, where the heating source is only one), it occurs much faster than thousands of years ago.

An increase in atmospheric carbon dioxide is that the level of carbon dioxide is getting increased and the level of global warming is getting increased.

What is the pollution ?

The pollution is the unwanted wastes that are coming out in the nature and the environment such that the level of increasing bad effects of air are increased.

It causes them to dry-up and shrink in size. It is because of the increased temperature that increases most importantly this condition of drying up and all. The sea level is increased when there is increase in water level due to the maximum water melting from glaciers that cause the water to increase in oceans.

Global warming is the intact reason that sounds so relevant to the situation where the condition is like that the increasing water will automatically level up other concerns as well that is because of the green house gases.

Learn more about carbon dioxide at :

https://brainly.com/question/3049557

#SPJ2

QUESTION 8

Sleep deprivation is linked to less activity in the CA1 region of the hippocampus.
O True
O False

Answers

True . I hope this answer is correct !

The first time you get an infection, your immune system responds
the same infection again, your immune system responds
If you become re-infected with
A. quickly, slowly
B. in 3 stages, in 1 stage
C. in 2 stages, in 3 stages
D. slowly, quickly

Answers

C because i look up what is what and found the same questions your welcome
It’s c because in 2 stages in 3 stages is correct

Each T cell has two kinds of receptors on its membrane: one for molecules normally found on the surface of __________ and one for a specific __________.

Answers

Each T cell has two kinds of receptors on its membrane: one for molecules normally found on the surface of Macrophages and one for a specific antigen .

TCRs are classified into two types: alpha beta and gamma delta. Both are heterodimers that are connected with invariant CD3 complexes on the cell surface.

The antigen receptor on most T cells, the T-cell receptor, is made up of two protein chains, T-cell receptor and T-cell receptor, and resembles a single Fab fragment of immunoglobulin in many ways. T-cell receptors are membrane-bound at all times.

Learn more about to receptors  visit here;

https://brainly.com/question/29343237

#SPJ4

If you divide the distance a car traveled by it's time of travel , you will calculate its

Answers

Answer:

speed

Explanation:

speed = distance ÷ time

distance = speed × time

time = distance ÷ speed

May someone help me with this please?

May someone help me with this please?

Answers

photosynthesis: CO2

i think so :)

Check all that apply to MEIOSIS.
A. 2 cell divisions
B. makes body cells
C. makes gametes
D. 1 cell division
E. creates 4 haploid unidentical cells
F. creates 2 identical diploid cells

I just need the letters which apply, thank you.

Answers

D, A, C is the answer I believe in

Which organelles would be present in cells of the salivary glands?

Answers

Answer:

ribosomes ,ER

Explanation:

production of enzymes

The ER, ribosomes, Golgi body, and many vesicles are present in the salivary gland.

What do you mean by organelle?

An organelle is a subcellular structure that, like an organ in the body, has one or more distinct duties to fulfill in the cell. The nuclei, which store genetic information, mitochondria, which provide chemical energy, and ribosomes, which assemble proteins, are among the most essential cell organelles.

In the salivary glands, cells that make an enzyme called amylase would be abundant, as would organelles. The ER, ribosomes, Golgi body, and many vesicles are all present. Protein synthesis is aided by these enzymes (making proteins).

learn more about cell organelles here:

https://brainly.com/question/13464273

#SPJ2

If your immune system can't actually stop you from getting ill, then why is it beneficial? Why is it evolved to work this way, instead of simply stopping every infection in its tracks?

Answers

The inmmune system is continuouly working in the human body. While no aggresive factore attacs the body the person feels no changes, however, when certain substances, germs or other factors enter the body the inmune system is activated. This happens when the body does not recognize those factores, which are called antigens.

When the inmune system is activated a number of proesses occur inside the human body. These processes generally allow the inmune system to identify the germ and learn how to fight it, so the next time the exact germ enters the body the inmune system will have information stored on how to fight it and the response will be faster.

Therefore, the first time a person encounters a certain disease he or she gets ill until the inmune system reacts and fights it. The next time the person encounters the same disease the person probably will not get sick.

The inmune system is beneficial because it allows the body to protect itself and save the information it needs to properly fight the disease in the future.

If the information on how to fight a specific germ is not available in the genetic material of the person then he or she, in orther to gain it, will eventually have to get ill or get vaccinated.

Other Questions
Can somebody help a sista out 7th grade math Can this be solved Chemistry balancing equation GIVEN Kfind [NO] given K = 0.028, [NO] = 0.0.042 M NO 2 NO Assume that securitization combined with borrowing and irrational exuberance in Hyperville have driven up the value of asset-backed financial securities at a geometric rate, specifically from $6 to $12 to $24 to $48 to $96 to $192 over a six-year time period. Over the same period, the value of the assets underlying the securities rose at an arithmetic rate from $6 to $9 to $12 to $15 to $18 to $21. If these patterns hold for decreases as well as for increases, by how much would the value of the financial securities decline if the value of the underlying asset suddenly and unexpectedly fell by $9 If a gain of $12000 is incurred in selling (for cash) office equipment having a book value of $110000, the total amount reported in the cash flows from investing activities section of the statement of cash flows is When populations are isolated, even for a short time, mutation at loci with epistatic interactions that are adaptive in their own unique combinations in different environments can __________(one or more words)_________________ in the hybrids when they come back into contact. Rewrite the 4cm: 8km as a ratio in the form 1: n If carl can type 180 words in 2 minutes. how many words can he type in 3 minutes? A student observed organisms found in the backyard garden. the student developed a model of the food web observed in the garden. answer all parts (a-d) in your responses. part a: construct an explanation that identifies the original source of energy for the robin and sparrow. part b: describe and provide evidence of the relationship between the grasshopper and the caterpillar. part c: construct an explanation that describes how matter and energy are transferred to and from the robin. part d: construct an explanation that describes how the matter is transferred back to the plants. help pls lot of points How does the marketing department help determine if a product is cost effective A. By identifying competitors B. By researching how much a customer is willing to pay for similar productsC. By researching the companies history D. By determining a target markets age ____conditioning is a type of learning in which organisms associated actions with consequences. which of the following statements is most accurate select an answer and submit. for keyboard navigation, use the up/down arrow keys to select an answer. a hydrogen ions released during lactate production are primarily responsible for blood acidosis b an accumulation of adp during exercise will inhibit creatine kinase activity. c during exercise, glycogen stored in non-exercising muscles help preserve blood glucose levels. d in non-muscle cells, lactate an be converted back to glucose, implying that it is an energy source. Solve the equation P = 3L + 2W for w HBF company has 50,000 shares outstanding which worth $I million in total. The Balance sheet of the company shows $250.000 of cash and $750.000 of other assets. If thecompany issues a SI- per share cash dividend, how is the shareholder wealth affected? Who ever can tell me who said these quotes will get 20 points and will get to be The BrainliestA: "I am a firm believer in the people. If given the truth, they can be depended upon to meet any national crisis. The great point is to bring them the real facts." Abraham LincolnB: "In a time of domestic crisis, men of goodwill and generosity should be able to unite regardless of party or politics." C: "When written in Chinese, the word crisis is composed of two characters -- one represents danger, and the other represents opportunity." D: "The most fortunate of us all in our journey through life frequently meet with calamities and misfortunes which greatly afflict us. To fortify our minds against the attacks of these calamities and misfortunes should be one of the principal studies and endeavors of our lives." if she continues shooting until she misses three, what is the probability that the third miss occurs on the 30th attempt true or false chances of death or injury at low speeds when the driver is unbelted are the same as those for belted drivers. In parallelogram wxyz, diagonals wy and xz intersect at a. wa= x^2 - 36 and ay = 5x. what is wy? enter your answer in the box. During your summer internship for an aerospace company, you are asked to design a small research rocket. The rocket is to be launched from rest from the earth's surface and is to reach a maximum height of 950 m above the earth's surface. The rocket's engines give the rocket an upward acceleration so it moves with acceleration of 16.0 m/s2 during the time T that they fire. After the engines shut off, the rocket is in free fall. Ignore air resistance. Assume that the acceleration due to gravity does not change with the height of the rocket.Required:What must be the value of T in order for the rocket to reach the required altitude? The stock of Ernst Electric has a beta of .87. The market risk premium (RM)is 8.6 percent and the risk-free rate (RF)is 3.7 percent. What is the expected return on Ernst Electric stock? SmallCircle 7.96 percent SmallCircle 10.58 percent SmallCircle 11.18 percent SmallCircle 12.20 percent SmallCircle 12.30 percent