Consider di-iron oxo enzymes/proteins (e.g., ribonucleotide
reductase (RNR), purple acid phosphates (PAP), and hemerythrin
(Hr)).
I) What are the oxidation states available to the Fe ions in a
typical

Answers

Answer 1

Di-iron oxo enzymes/proteins, such as ribonucleotide reductase (RNR), purple acid phosphatase (PAP), and hemerythrin (Hr), can exhibit various oxidation states for the iron ions. The most common oxidation states observed in these enzymes/proteins are Fe(II) and Fe(III).

In di-iron oxo enzymes/proteins, the iron ions can exist in different oxidation states, typically Fe(II) and Fe(III). These enzymes/proteins contain a binuclear iron center, where the two iron ions are coordinated by specific ligands.

In the Fe(II) state, the iron ions have a +2 oxidation state, meaning they have lost two electrons. This state is often associated with a reduced form of the enzyme/protein. Fe(II) can participate in various chemical reactions, including the transfer of electrons or binding and activation of oxygen.

In the Fe(III) state, the iron ions have a +3 oxidation state, indicating the loss of three electrons. This state is usually associated with an oxidized form of the enzyme/protein. Fe(III) can act as an oxidant or be involved in redox reactions.

The presence of different oxidation states allows di-iron oxo enzymes/proteins to perform their specific biological functions, such as catalyzing redox reactions, facilitating oxygen transport, or participating in phosphate hydrolysis. The interconversion between Fe(II) and Fe(III) states is often crucial for the enzymatic activity and regulation of these proteins.

Learn more about enzymes here: https://brainly.com/question/31385011

#SPJ11


Related Questions

ES CURABLE LA CLAMIDIA

Answers

Yes with proper medication clamidia is treatable

1. Do you think manufacturers of computers and television sets and other forms of e-waste
(Core Case Study) should be required to take them back at the end of their useful lives for
repair, remanufacture, or recycling? Explain. Would you be willing to pay more for these
products to cover the costs of such a take-back program? If so, what percent more per
purchase would you be willing to pay for electronic products?

Answers

1. The correct answer to the task above about e-wastes is that it should be recycled.

2. I won't be willing to pay more for the cost of take-back materials of devices simply because these devices still have components which will still be useful for the manufacturers.

Why wastes of electronic devices should be taken back for repair or recycling.

Computers, and others electronic devices; when they got broken or spoilt, needs to be recycled simply because the activities of of recycling back the devices makes more raw materials available for another re-manufacturing.

In conclusion, it can therefore be deduced from the explanation given above that recycling of substances is one of best ways of making them much more available where they are scarce.

Read more on recycling:

https://brainly.com/question/376227

#SPJ1

Look carefully under 400x magnification and relatively low light in order to see the ross walls representing the separate cells of the filament. Use yourrsciaphragm level to reduce the light level and increase image acuity. A. Below, draw one strand of Anabaena at 400x magnification and IDENTIFY EACH TYPE OF CELL FROM THE STRAND by circling them. Are all the cells dentical? Note that you may not see the very large akinete but should easily see heterocysts and vegetative cells (the most abundant) vegetative cet B. Use the diameter of the field of view at 400X from WeekLab Exercise to estimate wiath of the filaments. How wide is one cell of Anabaena? Show your calculations. 2 C. What color(s) are the cells? s green D What moleculets give them this color? heterotroph? Based exclusively on what you can see in the Is Anabaena an autotroph or-a image how do you know this?

Answers

A. Circle the heterocysts and vegetative cells. No, all the cells are not identical. B. Estimating the width of the filaments: Use the diameter of the field of view at 400x magnification. Calculate the width of one cell of Anabaena based on the known field of view. C. The color of the cells is green. D. The molecules that give the cells their green color are chlorophyll pigments. Anabaena is an autotroph, as it contains chlorophyll for photosynthesis.

Draw and identify Anabaena cells at 400x magnification. Estimate width and identify color and molecules responsible for it.
To draw and identify Anabaena cells at 400x magnification, one needs to look for the ross walls representing the separate cells of the filament under relatively low light.

One should use their diaphragm level to reduce light level and increase image acuity. The most abundant cells are vegetative cells, followed by heterocysts.

One can estimate the width of the filaments by using the diameter of the field of view at 400x. The cells are typically green due to chlorophyll and phycocyanin molecules.

This indicates that Anabaena is an autotroph, capable of producing its own food through photosynthesis.

For more such questions on molecules, click on:

https://brainly.com/question/13348791

#SPJ11

The flow of carbon from one carbon source to another is considered a carbon ___.
A. sink
B. flux
C.store
D. site

WILL MARK BRAINLIEST

Answers

Answer:

C.store of manila philippines is most beautiful in the earth

Explanation:

I think that is the true answer in this question please hearts me in brainly and give me a star ⭐

The answer is A.

The carbon flow is from the source cells such as leaf to the sink cells such as fruits.

Simplify the expression 53 + 3(5 − 3).
137
131
27
21

Question 4

Answers

\(\longrightarrow{\green{59}}\) 

\(\large\mathfrak{{\pmb{\underline{\red{Step-by-step\:explanation}}{\red{:}}}}}\)

\(53 + 3(5 - 3) \\ \\ = 53 + 3(2) \\ \\ = 53 + 6 \\ \\ = 59\)

Note:-

\(\sf\purple{PEMDAS\: rule.}\)

P = Parentheses

E = Exponents

M = Multiplication

D = Division

A = Addition

S = Subtraction

\(\bold{ \green{ \star{ \orange{Mystique35}}}}⋆\)

\(\mathrm{Follow\:the\:PEMDAS\:order\:of\:operations}\)

Calculate within parenthesis

\(5-3\\\\=2\)

\(=53+3\cdot \:2\)

Multiply and divide

\(3\cdot \:2\\\\=6\)

\(=53+6\)

Add and subtract

\(53+6\\\\= 59\)

So, the simplified expression of \(53 + 3(5 - 3)\) is 59

6. Which fossil type provides the most anatomical
information to paleontologists?

Answers

Answer:

amber

Explanation:

the amber completely preserves the specimen

The fossil type that provides the most anatomical information is amber

What is the upper most layer of the Atmosphere? (Not exosphere rn)
Troposphere
Mesosphere
Thermosphere
Stratosphere​

Answers

I think it’s thermosphere :)

glucose molecules are to starch as ________ are to proteins.

Answers

Answer:

Amino acids

Explanation:

Glucose molecules are to starch what amino acids are to proteins; the glucose molecules are the monomeric units of the starch, just as the amino acids are the monomeric units of the protein.

What is the significance of the monomers?

Polymers such as starch, protein, and fatty acids are found in living bodies such as those of animals and plants and polymers are made up of monomeric units such as glucose monomers that are bonded to each other by glycosidic bonds make starch, and amino acids are the monomeric units of proteins that are bonded by peptide bonds. These are necessary for the storage molecule, as well as for the cell's structural and functional units.

Hence, glucose molecules are to starch what amino acids are to proteins; the glucose molecules are the monomeric units of the starch, just as the amino acids are the monomeric units of the protein.

Learn more about the monomers here.

https://brainly.com/question/29340352

#SPJ5

A spring was at its resting position where it is attached to a wall at its left side and a block at its right side as shown below. The spring constant is k=75.0\,\dfrac{\text N}{\text m}k=75.0

m

N



k, equals, 75, point, 0, start fraction, start text, N, end text, divided by, start text, m, end text, end fraction. The block is moved leftwards and the spring's right end is displaced from the position of 0.250\,\text m0.250m0, point, 250, start text, m, end text to 0.150\,\text m0.150m0, point, 150, start text, m, end text where it is held in place. All positions are measured from the origin OOO of the wall.

Answers

Answer:

The force of spring will be "3.75 N". The further explanation is given below.

Explanation:

The given values are:

Spring constant, K = 75.0 N/m

x₁ = 0.200 m

x₂ = 0.150 m

So that,

⇒ \(x=x_{1}-x_{2}\)

⇒    \(=0.200-0.15\)

⇒    \(=0.05 \ m\)

Now,

Force of spring will be:

⇒  \(F=K\times x\)

On putting the estimated values, we get

⇒      \(=75\times 0.05\)

⇒      \(=3.75 \ N\)

Answer:

−8.25N

Explanation:

Hooke’s law says the restorative spring force is directly proportional to the change of the spring length x on top, but is opposite in direction to the change in spring length.

what do electrons in the same shell have in common​

Answers

Answer:It predicts and lists all chemical elements in the universe. What do electrons in the same shell have in common? They all have the same amount of energy. ... They cannot be broken apart without losing their chemical properties.

Explanation:I took a quiz on it

Electrons in the same shell, also known as the same energy level or principal quantum number, have energy, shielding effect, chemical behavior, etc. in common.

Electrons in the same shell have approximately the same energy level. The energy of an electron is determined by its distance from the nucleus, and electrons in the same shell are at a similar average distance from the nucleus.

Electrons in the same shell shield each other from the positive charge of the nucleus. This shielding effect reduces the attraction between the positively charged nucleus and the negatively charged electrons in the outer shells.

Electrons in the same shell participate in similar chemical reactions and exhibit similar chemical behavior.

Electrons in the same shell occupy orbitals with similar shapes. Each shell contains one or more subshells, which consist of specific orbitals that can accommodate electrons.

Thus, these are the properties of electrons in same shell.

For more details regarding electrons, visit:

https://brainly.com/question/12001116

#SPJ6

If a sound gets louder, the .....of its vibrations increases.

options:

amplitude

pitch

waves

Answers

Answer:

I think Amplitude

Explanation:

the form of asexual reproduction.

Answers

Answer:

There are a number of types of asexual reproduction including fission, fragmentation, budding, vegetative reproduction, spore formation and agamogenesis. ... In multiple fission (right), a multinucleated cell can divide to form more than one daughter cell. Multiple fission is more often observed among protists

Explanation:

I agree with the answer given above

por que un globo con aire se agranda al sol y se achica en la heladera

Answers

Answer: El globo congelado se contrajo porque la energía cinética promedio de las moléculas de gas en un globo disminuye cuando la temperatura disminuye. Esto hace que las moléculas se muevan más lentamente y tengan colisiones menos frecuentes y más débiles con la pared interior del globo, lo que hace que el globo se encoja un poco.

Explanation:

Name all the areas of the nephron that secretion takes
place:

Answers

The areas of the nephron where secretion takes place are the proximal convoluted tubule, the distal convoluted tubule, and the collecting duct.

The proximal convoluted tubule (PCT) is the nephron's initial segment. It is made up of a single layer of epithelial cells that form a lumen. The primary function of the PCT is to reabsorb essential substances, such as water and sodium ions, from the filtrate, which moves to the loop of Henle as tubular fluid. Secretion also occurs here, primarily for hydrogen and ammonium ions, as well as other waste materials.

Distal convoluted tubule: The distal convoluted tubule (DCT) is a portion of the kidney's nephron that lies between the loop of Henle's ascending limb and the collecting duct. The primary function of the DCT is to regulate the body's pH level and water content. The DCT secretes hydrogen ions, potassium ions, and organic ions that are not useful to the body. It absorbs sodium and water into the body's bloodstream while concurrently secreting potassium ions into the tubular fluid.

The collecting duct, which is the final part of the kidney's nephron, aids in the reabsorption of water and sodium ions. It's also where the last of the tubular fluid gets converted into urine. The collecting duct transports this urine to the renal pelvis through the renal papilla, which is the opening of the renal pyramid. The primary function of the collecting duct is to maintain the body's salt and water balance, which is crucial for regulating blood pressure and volume.

Learn more about proximal convoluted tubule: https://brainly.com/question/13949242

#SPJ11

duplicate this (dna)

aau cgg aua cgc uaa ggc uau

Answers

Answer:

aau cgg aua cgc uaa ggc uau

Explanation:

TY FOR THE POINTS


Which microfossils are useful for paleotemperature determination
using the oxygen isotope ratios of their shells?

Answers

The microfossils that are useful for paleotemperature determination using the oxygen isotope ratios of their shells are foraminifera.

Foraminifera are tiny marine animals that have been living for millions of years. Their shells are made up of calcium carbonate and are well-preserved in sediments. The shells of these microorganisms are widely used in paleoceanography to determine past climatic conditions. Paleoceanography is the study of the history of the oceans in the geological past using sediments and fossils. It helps us to understand how the oceans and climate have changed over time.

Paleotemperature is the measure of the temperature that existed in past geological ages. The temperature is determined by various means, including studying the growth rings of trees, ice cores, and microfossils, and others. Microfossils are microscopic fossils that are found in rocks and sediments that help in reconstructing past environmental and climatic conditions.

Oxygen isotope ratio is the measure of the relative abundance of oxygen isotopes 18O and 16O in a sample. The ratio of the two isotopes changes as a result of temperature changes. The ratio is used to reconstruct past temperature changes.

To know more about microfossils visit:

https://brainly.com/question/30840647

#SPJ11

What does pineapple and cranberry juice do for the female body.

Answers

Question
What does Pie apple and cranberry juice do for The remake Bosh

Answer
The answer is in The picture

Give me a brainliest as a thanks, Welcome
What does pineapple and cranberry juice do for the female body.

A firm has $820 in inventory, $3,200 in fixed assets, $1,210 in accounts receivable, $890 in accounts payable, and $360 in cash. What is the amount of the net working capital?
a. $4,700
b. $5,590
c. $3,600
d. $2,390
e. $1,500

Answers

The net working capital for the firm is $1,500, calculated by subtracting current liabilities from current assets, the correct option is (e).

To calculate the net working capital, you need to subtract the current liabilities from the current assets.

In a company's financial statements, the formula for calculating current assets can be expressed as the sum of inventory, accounts receivable, and cash.

Current Assets = Inventory + Accounts Receivable + Cash

Current Liabilities = Accounts Payable

Using the given values:

Current Assets = $820 (Inventory) + $1,210 (Accounts Receivable) + $360 (Cash)

= $2,390

Current Liabilities = $890 (Accounts Payable)

The formula to calculate Net Working Capital is derived by subtracting Current Liabilities from Current Assets.

Net Working Capital = Current Assets - Current Liabilities

Net Working Capital = $2,390 - $890

= $1,500

Therefore, the amount of net working capital is $1,500.

Hence, the correct option is (e).

To learn more about liabilities follow the link:

https://brainly.com/question/15006644

#SPJ4

The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?

Answers

Answer: Because they cause a disturbed ecosystems.

Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.

Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.

Name a pink stain used for observing plant specimen under compound microscope

Answers

Answer:

Eosin Y

Explanation:

Eosin Y stains alkaline cell parts (like cytoplasm) pink. use on plants,animals and blood. can also be used as a substitute for Congo Red and Carmine.

Inflammation of the fibrous connective tissue of the subcutaneous layer of skin is the ____

Inflammation of the fibrous connective tissue of the subcutaneous layer of skin is the ____

Answers

the answer to your question should be hypodermis

tell me if im wrong, if not, brainliest plsss?

Why has the number of people in the world increased if the human population growth rate has decreased?

Answers

Answer:

Life expectancy has steadily risen.

People live longer lives.

To understand the reasons why the number of people in the world has increased and the population growth rate has decreased, it is necessary to understand how the world's demographic growth rate is calculated.

The calculation is made from the balance between the total number of people alive and the total number of deaths that occurred in a period of time.

Therefore, we can understand that the population growth rate has decreased due to several relevant factors, such as:

Increased life expectancy.The decrease in infant mortality.Rising fertility rates.Urbanization.Economic development.

These are some of the reasons that help us understand why population numbers increase and population growth rate decreases.

Economic development, new technologies and a better quality of life for the population are directly related to the decrease in the population growth rate.

Learn more here:

https://brainly.com/question/13874654

The numbers represent the change in energy for a chemical reaction. They are calculated by subtracting the energy of products from the energy of reactants. Which number would result from an endothermic reaction?

–212
0
-1
800

Answers

The energy is calculated by subtracting the energy of products from the energy of reactants, and the positive energy shows the endothermic reaction. The correct answer is "800," which can be found in the final option.

What are the various types of reactions?

               

There are different types of reactions, such as the endothermic reaction, where the energy is used for the product's formation, and the exothermic reaction. The energy is released in an exothermic reaction, resulting in a negative result, whereas the energy is used in an endothermic reaction, resulting in a positive result.

Hence, the endothermic reaction is the 800 that is present in the last option.

Learn more about the types of reactions here.

https://brainly.com/question/23184814

#SPJ1

Answer:

d. 800

Explanation:

The numbers represent the change in energy for a chemical reaction. They are calculated by subtracting the energy of products from the energy of reactants. Which number would result from an endothermic reaction?

800

Glycolysis is a 10-step pathway, in which reactions four through nine are reversible. With so many reversible reactions, how does the pathway have an overall directionality towards pyruvate (Pyr)?

Answers

Despite the reversibility of reactions four through nine in the glycolysis pathway, the overall directionality towards pyruvate is maintained through regulation of the pathway enzymes and thermodynamic constraints.

Firstly, the enzymes responsible for the irreversible reactions in glycolysis, such as hexokinase and pyruvate kinase, are highly regulated and only active under specific conditions. This ensures that the irreversible reactions proceed in the forward direction, while the reversible reactions can proceed in either direction depending on the needs of the cell.
Secondly, the thermodynamics of the reversible reactions also contribute to the overall directionality of the pathway. For example, reactions six through nine involve the conversion of two ATP molecules to two ADP molecules. This results in a negative change in Gibbs free energy, making the overall direction of these reactions towards pyruvate and the production of ATP.
Overall, the regulation of enzyme activity and thermodynamic constraints work together to maintain the overall directionality of the glycolysis pathway towards pyruvate.

learn more about glycolysis

https://brainly.com/question/30828407

#SPJ11

Jamal has some counters in a bag.

36% of the counters are red

the rest of the counters are yellow

Jamal puts 50 blue counters into the bag.

Now 25% of the counters in the bag are blue.

Work out the number of yellow counters in the bag.

Answers

there are 32 yellow counters in the bag.

About 36% of the counters are red, so the proportion of red counters is: 0.36

The proportion of yellow counters in the original bag is therefore:

\(1 - 0.36 = 0.64\)

Next, Jamal adds 50 blue counters to the bag. Let's say that the original number of counters in the bag was x. After adding 50 blue counters, the total number of counters in the bag is x + 50.

As 25% of the counters in the bag are now blue. So the number of blue counters in the bag is:

\(0.25(x + 50)\)

Similarly,

Red counters: 0.36x (since the proportion of red counters is still the same)

Yellow counters: (0.64)x (since the proportion of yellow counters is still the same)

The total number of counters in the bag is the sum of the red, yellow, and blue counters:

\(x + 50 = 0.36x + 0.64x + 0.25(x + 50)\)

Simplifying this equation, we get:

\(x + 50 = 1x + 0.25x + 12.5\)

Combining like terms, we get:

\(0.75x = 37.5\)

Dividing both sides by 0.75, we get:

\(x = 50\)

So there were originally 50 counters in the bag. We can now find the number of yellow counters in the bag:

Yellow counters = \((0.64)x = (0.64)(50) = 32\)

To know more about counters click here

brainly.com/question/27311069

#SPJ4

how does the mixed polarity/nonpolarity of phospholipids and membrane proteins determine the structure of the cell membrane?

Answers

The mixed polarity/non-polarity of phospholipids and membrane proteins plays a crucial role in determining the structure of the cell membrane. The interaction between phospholipids and membrane proteins determines the overall shape of the cell membrane.

Phospholipids have a polar head and a nonpolar tail, which creates a bilayer structure. The hydrophobic tails face inward, creating a barrier to water-soluble molecules, while the hydrophilic heads face outward, interacting with water. Membrane proteins can also have both polar and nonpolar regions, which allows them to be embedded in the phospholipid bilayer.

The interactions between these molecules help to determine the overall shape and function of the cell membrane, including its ability to selectively allow molecules to pass through the membrane.

For more such answers on Phospholipids

https://brainly.com/question/12148124

#SPJ11

A new animal arrived in an ecosystem. Make a prediction on what will happen to the dominate and non- dominate plants if this new animal were to solely eat the dominate plant?

Answers

Answer:

is this a typing response or select the correct answer type question

Explanation:

Please answer the image

Please answer the image

Answers

Should be to see how different types of organisms effect eachother!

Which process turns glucose into energy?

Breathing
Cell division
Cellular respiration
Photosynthesis

Answers

Answer:

cellular respiration

Explanation:

cellular respiration

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Please help :). Will give brainiest!! I only need the first part dont answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA
Other Questions
help.............now please Kennedy quotes the explorer George Mallory's words "Because it is there." How does this quotation help to strengthen Kennedy's speech? A cell phone company charges its customers $40 each month for owning a cell phone plan and $0.25 foreach minute the customer talks on the phone. These costs are modeled by the following equation:C=25m +40, where Crepresents the total cost of the bill and m represents the number of minutes thecustomer talked on the phone that month. Given this equation, how many minutes would the customerhave to talk on the phone for their monthly bill to be $84.25? (Hint: plug in 84.25 for the total cost, C, andsolve for the unknown, m). ScenarioYou are a sophomore in highschool and would like to apply to the Jr. Camp counselor position.Brainstorm a list of strengths you can bring to this position (as many as you can think of)Brainstorm high school experiences you can use to answer interview questions (as many as you can think of)Now brainstorm a response for the following question:Can you describe a challenge that you had and how you handled it?S- Senior in high school and just moved into the school zone (new to the school)T-completing a paper on a subject I knew nothing about for Social StudiesA-Talked to teacher, researched the topic, created an outline, had teacher review my outline, go back and research some more, write the paperI was new to my school and I found out I had to write a paper in social studies on a topic I had never been taught. It is common for the client to do what if euthanasia was handled without the utmost care and respect? Given the values of x and y find the exact (fraction) values of all six trig ratios For a given data set, if the 95% confidence interval for u is (.004, .396) and the 99% confidence interval for is (-0576, .4576), then at which significance level(s) the alternative hypothesis H0 : =0? can the null hypothesis HA : 0 ? A) .01 but not .05 B).05 and .01 C) .05 but not .01 D) Neither 05 nor .01 E) It cannot be determined Vertical Restrain is: a, A restrain of trade created by an agreement between firms at different levels in the manufacturing and distribution process. b. Going up the corporate ladder c. All of the Above. d. Any agreement that restrains competition between rival firms competing in the same market Which types of species tend to dominate river ecosystems? How do conditions between fast-moving 'headwaters' (or sources) of rivers differ from slow-moving 'mouths' of rivers? Where are the majority of producers in a lake located? Where would you expect to find the largest food webs - oligotrophic, mesotrophic, or eutrophic lakes? Explain. What characteristic defines a wetlands? Why are wetlands so ecologically productive, and what valuable ecosystem services do they provide to humans? Where are coral reefs generally found, how are they built, and why are they under heavy threat from bleaching? Do the vast open oceans areas deeper than ~200 meters and away from coastlines support much life? Explain What is the value of Fraction 1 over 2x3 + 3.4y when x = 2 and y = 5? given strong narcotics regularly and in sufficient amounts, dying persons with severe pain will likely experience . What type of organization integrates the activities of specialists within a functional framework?A.) traditionalB.) projectizedC.) matrix A random sample of the closing stock prices in dollars for a company in a recent year is listed below. Assume that sigma is$2.31. Construct the 90% and 99% confidence intervals for the population mean. Interpret the results and compare the widths of the confidence intervals. 20.66 16.32 19.16 22.78 19.68 17.76 21.39 16.06 15.33 19.89 20.08 17.37 19.65 21.56 16.01 16.12 The 90% confidence interval is left parenthesis $ nothing comma $ nothing right parenthesis . (Round to two decimal places as needed.) The99% confidence interval is left parenthesis $ nothing comma $ nothing right parenthesis . (Round to two decimal places asneeded.) Which statement below interprets the results correctly?90% of the mean closing stock prices are in the 90% confidence interval and 99% of the mean closing stock prices are in the 99% confidence interval. The probability that the mean closing stock price is in the 90% confidence interval is about 90% and the probability that the mean closing stock price is in the 99% confidence interval is about 99%. The 90% confidence interval contains the mean closing stock price 90% of the time and the 99% confidence interval contains the mean closing stock price 99% of the time. There is 90% confidence that the mean closing stock price is in the 90% confidence interval and 99% confidence that the mean closing stock price is in the 99% confidence interval. Which interval is wider? The 90% confidence interval The 99% confidence interval a statue enacted by the wyoming state legislature to regulate trucking affects interstate commerce. in evaluating this statute, the courts will weight the burden that it imposes on interstate cmmerence against On a coordinate plane, parallelogram P Q R S is shown. Point P is at (negative 2, 5), point Q is at (2, 1), point R is at (1, negative 2), and point S is at (negative 3, 2). In the diagram, SR = 4 StartRoot 2 EndRoot and QR = StartRoot 10 EndRoot. What is the perimeter of parallelogram PQRS? Three hours after undergoing an uncomplicated tonsillectomy for obstructive sleep apnea, an obese 10 year old boy's temperature increases to 40.5C(104.9F). His pulse is 130/min, respirations are 30/min with deep breathing, and blood pressure is 90/60 mm Hg. Blood pressure obtained perioperatively was 105/70 mm Hg. The skin is mottled. The tonsillar bed is intact, and there is no excessive bleeding. The thyroid gland is not enlarged. Bilateral basilar crackles are heard. The precordium is hyperdynamic with no rubs or gallops. The extremities are cool, and there is generalized muscle rigidity. Laboratory studies show:- Prothrombin time 17 sec(INR=1.5)- Partial thromboplastin time 48 sec- Urine- Blood 2+- Protien 2+- RBC/WBC none- Organisms noneA. Malignant hyperthermiaB. Myocardial infarctionC. MyocarditisD. SepsisE. Thyroid storm Write a summary of page 1 of today's Article. As you write your summary, do the following:STEP 1: Read page 1 of the Article in order to understand the text.STEP 2a: Locate the topic sentence for each paragraph.STEP 2b: Get rid of any details that are not needed.STEP 2c: Put the informationin your own wordsinto a single paragraph.STEP 3: Rethink your summary.STEP 4: Re-read your summary. Make final corrections. Please see attached picture. Need help answering. employees at biquell corporation are paid $15,000 cash every friday for working monday through friday. the calendar year accounting period ends on wednesday, december 31. how much salaries and wages expense should be recorded two days later on january 2? group of answer choices none, expense recognition requires the weekly salary to be accrued on december 31. $9,000 $15,000 $6,000 A baseball team averages one win to every one loss. Use a simulation to find each experimental probability for three games.P(1 win and 2 losses) and P(three losses)