Explain the importance of

• "push" factor • Know-Nothing Party

• "pull" factor

Answers

Answer 1

The "push" factor and the "pull" factor are concepts used to understand the reasons behind migration and population movements.

The "push" factor refers to the conditions or circumstances in a person's home country or region that "push" them to leave and seek opportunities elsewhere.

These factors can include economic hardships, political instability, religious persecution, natural disasters, or lack of basic amenities. The push factor represents the negative aspects or motivations that prompt individuals or groups to migrate.

The "pull" factor, on the other hand, refers to the conditions or opportunities in a destination country or region that "pull" individuals or groups to migrate there.

Understanding the push and pull factors is crucial in analyzing migration patterns and developing policies to address them effectively.

The Know-Nothing Party was a political party that emerged in the United States in the mid-19th century, primarily during the 1850s. Also known as the American Party, it gained prominence due to rising nativism and anti-immigrant sentiment at the time. The party opposed immigration, particularly from Catholic countries, and aimed to protect the interests of native-born Protestant Americans.

The Know-Nothing Party's platform was rooted in xenophobia and sought to limit the political power and influence of immigrants, especially Catholics and Irish immigrants.

While the Know-Nothing Party did gain some electoral success in the 1850s, its influence waned over time. However, its legacy serves as a reminder of the historical nativist sentiments and anti-immigrant movements that have shaped immigration policies and debates in the United States.

To learn more about migration

https://brainly.com/question/1653134

#SPJ11


Related Questions

What influence has immigration had on the region?|

Answers

Answer:

more innovation, a better educated workforce and greater occupational specialization

Explanation:

Each new settlement in colonial New England drew up a ______ to formalize settlers' commitment to unity and harmony.

Answers

Each new settlement in colonial New England drew up a covenant to formalize settlers' commitment to unity and harmony.

What is a covenant?

A covenant is an agreement, which in this case is a formal document, drawn up by early settlers in colonial New England to define the terms and conditions of their colony. The settlers believed that their new homes would be successful only if they worked together, so they came up with a covenant to formalize their commitment to unity and harmony. In order to bring harmony and support in the new settlement, all members of the community had to agree to it. It ensured the harmony and unity of the settlers and promoted cooperation, thus reducing the possibility of conflict. The covenant also helped the people to uphold order and togetherness among them.What was in a covenant?The covenants included a statement of purpose, the location, a commitment to living according to religious principles, an agreement to support the religious leader and community, and a pledge of solidarity. It was a type of social contract that was agreed upon by the members of the community to ensure that everyone lived according to shared principles and norms.

To know more about covenant visit:

https://brainly.com/question/31261715

#SPJ11

Explain MacAuthur’s post WWII plan for Japan.

Answers

Answer:

After the defeat of Japan in World War II, the United States led the Allies in the occupation and rehabilitation of the Japanese state. Between 1945 and 1952, the U.S. occupying forces, led by General Douglas A. MacArthur, enacted widespread military, political, economic, and social reforms.

Which statement best describes Huey Long, Upton Sinclair, and Dr. Francis Townsend?
a They all ended up in jail during World War II for having communist sympathies.
b Despite representing interesting movements, none of them had much of a following.
c They all challenged Roosevelt to move further to the left of center.
d Each was a socialist radical.
e They were all supported by the Republican Party.

Answers

Huey Long, Upton Sinclair, and Dr. Francis Townsend C: They all challenged Roosevelt to move further to the left of center.

Huey Long, a senator from Louisiana, proposed a "Share Our Wealth" program that aimed to redistribute wealth and limit the power of the rich. Upton Sinclair, a writer and political activist, ran for governor of California on a platform that included ending poverty and improving workers' rights.

                                   Dr. Francis Townsend advocated for a pension plan for the elderly that ultimately influenced the creation of Social Security. All three challenged President Roosevelt's New Deal policies, urging him to take more drastic actions to address economic inequality.

The statement that best describes Huey Long, Upton Sinclair, and Dr. Francis Townsend is  They all challenged Roosevelt to move further to the left of center.

All three individuals held political views that were more progressive than those of President Franklin D. Roosevelt and pushed for reforms that went beyond the policies of the New Deal. While they each had their own unique ideas and movements, they collectively aimed to push the political landscape further to the left.

Learn more about Huey Long

brainly.com/question/30237229

#SPJ11

Recommend TWO ways in which women and children can be
protected from discrimination and violence.​

Answers

Answer and Explanation:

Two ways women and children can be protected from discrimination and violence is the government putting up laws saying that women and children can't be abused, harmed, or have anything happen to them negatively, which include granting rights to them, and also allow them to do just as much as men do, such as be in the same workplace. For children, there should be many teachers on campus who are ready to help  and protect the children, along with making sure their voices are heard if they want to say something or if they need to share what they are going through.

#teamtrees #PAW (Plant And Water)

the nation’s first vice president, john adams, once noted, "i am vice president. in this i am nothing, but i may be everything." what did adams mean by this?

Answers

Essentially, John Adams was expressing the idea that the role of vice president in the early years of the United States was quite limited and didn't hold much power or authority.

Adams himself famously described the position as "the most insignificant office that ever the invention of man contrived or his imagination conceived."
However, despite the limitations of the office, Adams recognized that as vice president, he had the potential to become something more.

He saw himself as a key figure in the development of the young nation and recognized that his position could give him the platform he needed to make a real impact.

In that sense, he believed that he had the potential to become "everything" despite the fact that his role was initially seen as "nothing."

Know more about John Adams  here:

https://brainly.com/question/1069780

#SPJ11

Why do you think the confederacy afopted a constitution similar to the United States

Answers

In defiance of the Union and the US Constitution, the Confederacy established the Confederate Constitution.

The Confederate Constitution sought distinct assurances of states' rights and defended slavery as an institution, which were the two main differences between the two.

The Confederate government resembled that of the United States in many ways. The Constitution of the Confederate States was similar to that of the United States, except it placed more emphasis on states' rights and openly supported the enslavement of African Americans.

A line-item veto and a nonrenewable six-year presidential term are also provisions of the Confederate constitution. It reaffirms the notion of state's rights that had prevailed under the Articles of Confederation and expressly endorses slavery.

To learn more about  Confederate constitution, refer

https://brainly.com/question/4821060

#SPJ1

In your own words, describe Napoleon's exile on St. Helena ( 11 points !)

Answers

Answer:

Napoleon's exile on St. Helena

Explanation:

Napoleon Bonaparte was one of the great General in history. His military strategies earned him a reputation among people in Europe. He led the Napoleonic wars in Europe to extend its control over European countries which led him to conquer many countries like Egypt, Italy, etc. After the Battle of Waterloo, he was captured as a British prisoner and exiled to the island of Saint Helena situated in the Atlantic Ocean in the southern region, where he lived the rest of his days.

To what extent can you say that the Ghanaian civil
service is a bureaucratic organization

Answers

The Ghanaian civil service is a bureaucratic organization. Ghanaian civil service is a government institution that manages the administrative side of the government.

The Ghanaian civil service has a well-defined hierarchy, rules, and regulations. This means that a bureaucratic organization is not a pejorative term but rather a technical term for a particular type of organization that is characterized by a defined hierarchy, specialization of labor, rules and regulations, and impersonal relationships.

It is also characterized by a focus on administrative tasks and procedures rather than policy-making and a preference for standardized methods of operation. Ghanaian civil service is a typical bureaucratic organization because it satisfies the characteristics of a bureaucratic organization. Ghanaian civil service has a formal hierarchy that governs decision-making, and there are established rules and procedures that employees must follow.

The Ghanaian civil service's employees have specialized skills and training that are necessary for their particular role, and there is a clear division of labor. Employees in the Ghanaian civil service operate under a set of standard operating procedures and are held to the same standards as other employees in the organization.

To know more about  Ghanaian civil service refer here : brainly.com/question/32570645

#SPJ11

Compare and contrast about Ancient Aksum and Ancient Harar Jugol.

Answers

Ancient Harar had five walled gates that surrounded the city. Aksum served as a major hub between the African, Arab, European, and Indian trade communities. These gates not only served as protective barriers for the city, they also divided Harar Jugol into five separate Neighborhoods.

Your Brainly Guide

Give any two features of Socialism. Why were socialists against private
property and saw it as the root of all social evils?

Answers

Answer:

In a socialist economy, there is great equality of income distribution as compared with a free market economy. The elimination of private ownership in the means of production, private capital accumulation, and profit motive under socialism prevent the amassing of large wealth in the hands of a few rich persons.

only for 25d ight/............................................

Answers

Answer:

What? im lost

Explanation:

HURRY DAMMIT


A clothing company is deciding whether to make wool sweaters from yarn that is spun and dyed by individual craftspeople or from yarn that is mass-produced by machines.

What should the company consider about scarcity before making a decision?

Handcrafted yarn will be less scarce because it does not require a factory to produce it.
Mass-produced yarn will be less scarce because it does not require a factory to produce it.
Mass-produced yarn will be scarcer because it takes more time and labor to produce it.
Handcrafted yarn will be scarcer because it takes more time and labor to produce it.

Answers

Answer: Handcrafted yarn will be scarcer because it takes more time and labor to produce it.

Explanation: Scarcity in economics is a term describing finite resources, or the perception of limited resources, when there’s not enough to fulfill human needs and wants. Scarcity affects the monetary value people place on goods and services and how governments and private firms decide to distribute resources. Things that are scarce, like gold, diamonds, or certain kinds of knowledge, are more valuable for being scarce because sellers of these goods and services can set higher prices.

Handcrafted yarn will be scarcer than mass-produced yarn because it takes more time and labor to produce it. Time and labor are limited resources that have alternative uses. For example, a craftsperson could use their time and labor to make something else instead of yarn. Therefore, handcrafted yarn has a higher opportunity cost than mass-produced yarn. Opportunity cost reflects the inputs’ scarcity.

Mass-produced yarn will be less scarce than handcrafted yarn because it does not take as much time and labor to produce it. Machines can produce yarn faster and more efficiently than humans. Therefore, mass-produced yarn has a lower opportunity cost than handcrafted yarn.

The company should consider how scarcity affects the supply and demand of yarn before making a decision. Supply is the amount of a good or service that sellers are willing and able to offer at a given price. Demand is the amount of a good or service that buyers are willing and able to purchase at a given price. The price of a good or service is determined by the interaction of supply and demand in a market.

If the company chooses to make wool sweaters from handcrafted yarn, it will face a lower supply and a higher price of yarn. This means that the company will have to pay more for the raw material and may not be able to produce as many sweaters as it wants. The company will also have to charge a higher price for its sweaters to cover its costs and make a profit. This may reduce the demand for its sweaters, as some buyers may not be willing or able to pay the higher price.

If the company chooses to make wool sweaters from mass-produced yarn, it will face a higher supply and a lower price of yarn. This means that the company will have to pay less for the raw material and may be able to produce more sweaters than it wants. The company will also be able to charge a lower price for its sweaters and still make a profit. This may increase the demand for its sweaters, as more buyers may be willing and able to pay the lower price.

The company should weigh the pros and cons of each option and decide which one maximizes its utility, or satisfaction, given its budget constraints and preferences.

Hope this helps, and have a great day! =)

Answer:

hey !!

1. Availability of resources: The scarcity of raw materials required for yarn production, such as wool, needs to be considered. If the supply of high-quality wool is limited, using it for individual craftspeople's yarn may result in a higher opportunity cost for the company.

Cost of production: Scarcity can affect the cost of production. Mass-produced yarn may be more cost-effective due to economies of scale and the availability of machinery, whereas yarn produced by individual craftspeople might require higher labour costs and specialized skills.

Time and efficiency: Consider the time required to produce yarn using either method. If the demand for wool sweaters is high, mass-produced yarn could be more efficient in meeting customer demands within shorter timeframes. Individual craftspeople may have limited capacity and slower production rates.

Uniqueness and craftsmanship: Scarcity can also create value in terms of uniqueness and craftsmanship. Yarn spun and dyed by individual craftspeople might result in higher-quality and more distinctive products, appealing to customers seeking handcrafted, artisanal items. This uniqueness can be a competitive advantage.

Consumer preferences: The company should consider customer preferences and market trends. Some customers may be willing to pay a premium for products made with artisanal yarn, while others may prioritize the affordability and availability offered by mass-produced yarn.

To clarify, scarcity refers to the limited availability of a resource relative to its demand. In the context of yarn production, scarcity can be understood differently based on the factors involved:

Availability and production capacity: Handcrafted yarn may be considered scarcer if there are limited craftspeople available or if the production capacity is low. It requires skilled individuals to spin and dye the yarn, and if there is a shortage of such artisans, the availability of handcrafted yarn may be limited.

Scalability and production efficiency: Mass-produced yarn, on the other hand, benefits from economies of scale and production efficiency. With machinery and automated processes, mass production can meet higher demands more quickly and consistently. In this sense, mass-produced yarn is less scarce in terms of availability and production capacity.

It's important to note that scarcity can be evaluated from different perspectives. If we focus on the scarcity of labour and time, handcrafted yarn may indeed be scarcer due to the manual labour and time-intensive nature of the process. However, if we consider availability and scalability, mass-produced yarn may be less scarce due to its ability to meet larger market demands.

hope this helps :)

Why do you think it is important for a Consfifufion to be flexible?

Answers

I have no idea

Explanation:

Thing is it's asking you because it says "Why do you think So there is no right or wrong answer

one difference berween the societies of southern south asia and northern south asia during period 1200 1450

Answers

One difference between the societies of southern South Asia and northern South Asia during the period 1200-1450 was their dominant cultural and religious influences. These different cultural and religious influences resulted in distinct social, political, and artistic developments in southern and northern South Asia during the period 1200-1450.

During the period 1200-1450, southern South Asia and northern South Asia experienced different cultural and religious influences that shaped their societies in distinct ways. In southern South Asia, the dominant cultural and religious influence was Hinduism. The region saw the rise and flourishing of Hindu empires, such as the Vijayanagara Empire and the Hoysala Empire. Hinduism played a significant role in shaping the social structure, religious practices, and artistic expressions of the society in southern South Asia during this period.

On the other hand, northern South Asia was characterized by the dominance of Islam during the same period. The Delhi Sultanate, established by Muslim rulers, exerted control over the region and brought Islam as a prominent religion. The society in northern South Asia was influenced by Islamic traditions, including the establishment of Muslim dynasties, the introduction of Persian language and culture, and the spread of Sufi orders.

Learn more about southern South Asia here:

brainly.com/question/16330915

#SPJ11

Why did popularity of English women's soccer change in 1921 ?
A. FIFA, an organization run by men, banned women's soccer.
B. The demand for watching women's soccer decreased.
C. Women's soccer had their first World Cup.
D. The supply of women players significantly decreased.

Answers

Answer:

The correct answer is B

The demand for watching women's soccer decreased

Why is the marginal cost curve the same basic shape, no matter the product?

Answers

The marginal cost curve tends to exhibit the same basic shape across different products due to certain economic principles that are commonly observed in production processes.

While specific factors can lead to variations in the curve's exact position and slope, the underlying reasons for its shape are generally consistent. The marginal cost curve depicts the relationship between the quantity of output produced and the corresponding change in total cost incurred when producing an additional unit.

Here are some key reasons for the similarity in shape:

Law of Diminishing Marginal Returns: As production increases, the law of diminishing marginal returns comes into play. Initially, as more units are produced, the marginal cost tends to decrease due to economies of scale and improved efficiency. However, at a certain point, the marginal cost starts to increase as diminishing returns set in.

Spreading Fixed Costs: Fixed costs, such as rent, machinery, and equipment, are incurred regardless of the level of production. These costs are spread over a larger quantity of output as production increases, leading to a decrease in marginal cost.

Increasing Variable Costs: Variable costs, such as labor and raw materials, typically increase as production expands. These costs contribute to the upward slope of the marginal cost curve as more units are produced.

Technological Constraints: Technological limitations or production processes can also influence the shape of the marginal cost curve. For example, certain industries may face bottlenecks or limitations that cause marginal costs to rise more sharply at specific production levels.

know more about economic here:

https://brainly.com/question/27247297

#SPJ8

2 features of the colonisation of Virginia

Answers

2 features of the colonisation of Virginia are Jamestown was the first permanent English settlement in the New World and It provided England with fertile land and great wealth in the form of the cash crop, tobacco.

Queen Elizabeth granted permission to the famous Sir Walter Raleigh to be the first to establish colonies in the Americas. The colony was named 'Virginia,' after the virg in queen, and was intended to challenge Spanish Imperial interests.

The failure of Virginia colonization can be attributed in part to Native American resistance, but the ultimate cause was a lack of planning and organization that went into the region's settlement/colonisation, which was caused by a lack of clear leadership once the settlers arrived.

To know more about Virginia, click here.

https://brainly.com/question/19497558

#SPJ1

Explain what you think / believe John Adams should have done differently in his Presidency ?

Answers

I believe John Adams should have done differently in his Presidency in

areas regarding areas of conflict and human rights.

John Adams was the President of the United States which signed the

Sedition act in 1798.

What is Sedition Act?

Sedition act was aimed at punishing those who talked ill or made

publications criticizing the government. The then President had the belief

that danger and threat to the government will come from anarchy and other

forms of conflicts.

Instead of focusing on other vital reas, he focused on trampling on human

rights of the citizenry which was why he wasn't reelected.

Read more about John Adams here https://brainly.com/question/891955

After the Civil War, how did the United States encourage the incorporation of its western territories?
a.It encouraged settlers to move to the hinterlands with promises of cheap land for homesteading.
b.It encouraged exploration and development of mineral resources.
c.It recruited territorial residents into its new national army.
d.It enticed farmers to move west by guaranteeing them profits from producing farm goods to meet American consumers' insatiable demands.

Answers

After the Civil War, the United States encouraged the incorporation of its western territories by encouraging settlers to move to the hinterlands with promises of cheap land for homesteading.

Following the Civil War, the United States sought to expand its influence and population in the western territories. The Homestead Act of 1862 provided individuals with the opportunity to claim up to 160 acres of public land for a small fee after meeting certain requirements, such as living on and improving the land for a specified period of time. This policy aimed to entice individuals and families to venture westward, cultivate the land, and establish settlements.

Furthermore, the United States government promoted the exploration and development of mineral resources in the western territories. The discovery of gold, silver, and other valuable minerals sparked a wave of mining rushes and attracted prospectors from all over the country.In addition to homesteading and mining, the United States also encouraged the recruitment of territorial residents into its new national army. The military played a crucial role in expanding American control over the western territories, particularly in conflicts with Native American tribes and in enforcing federal authority.

These efforts contributed to the westward expansion of the United States, the growth of settlements, and the eventual establishment of states in the western frontier.

To learn more about Civil War click here:

brainly.com/question/11874600

#SPJ11

the women's rights movement fractured along racial lines because?

Answers

The women's rights movement fractured along racial lines primarily due to differing experiences and priorities shaped by the intersecting dynamics of race, gender, and class.

The mainstream women's suffrage movement in the United States was predominantly led by white women who focused primarily on securing voting rights for themselves.Women of color, particularly Black women, faced additional layers of discrimination and oppression stemming from racial inequality.The experiences of women of color, including the harsh realities of racism and segregation, led them to advocate for broader social justice issues beyond suffrage alone. They recognized that the fight for gender equality must also address the systemic racism and racial violence faced by communities of color.The mainstream suffrage movement often marginalized or excluded women of color, reinforcing racial divisions within the broader struggle for women's rights. The emphasis on a single-issue agenda and the prioritization of the concerns of white women created a division and limited the ability to build a united front.The fracturing of the women's rights movement along racial lines highlights the importance of intersectionality in understanding social justice movements. It underscores the need for recognizing and addressing the distinct experiences and challenges faced by different groups of women based on their racial identities, in order to foster a more inclusive and comprehensive movement for gender equality.

For more such questions on women's rights movement

https://brainly.com/question/14986743

#SPJ8

the wagner act: question 6 options: created the works progress administration. allowed the national labor relations board to supervise union elections. sponsored ballet and modern dance programs. made all unions illegal. affected only government employees.

Answers

The National Labor Relations Board was given the ability to oversee union elections according to the Wagner Act. Option 2 is Correct.

It required employers to engage in collective bargaining with unions chosen by a majority of the workers in a suitable bargaining unit, and it granted employees the freedom to create and join unions under Section 7. The Wagner Act, often known as the National Labor Relations Act of 1935, is the most significant labor law passed in the United States during the 20th century.

Today, the Wagner Act remains as a tribute to the New Deal's reform initiatives and to Senator Robert Wagner's perseverance in shepherding the legislation through Congress in order for President Roosevelt to sign it into law. We can infer that the Wagner is employed by a variety of businesses. Hence, Option 2 is Correct.

Learn more about wagner act Visit: brainly.com/question/25970080

#SPJ4

Correct Question:

The wagner act: options:

1. created the works progress administration.

2. allowed the national labor relations board to supervise union elections.

3. sponsored ballet and modern dance programs. made all unions illegal.

4. affected only government employees.

pls help me :(
no plato or edmentum answers

pls help me :(no plato or edmentum answers

Answers

Answer:

Napoleon was exiled to the island of Elba after his defeat in the War of the Sixth Coalition in 1814. He was able to escape and return to France in March 1815, which is known as the Hundred Days. This information is important to Napoleon's life story as it highlights his determination and resilience, as well as his ability to influence and rally support from the French people.Source: "Napoleon Bonaparte," History.com,

Napoleon implemented a new legal code, known as the Napoleonic Code or Civil Code, which was adopted by several countries in Europe and Latin America. The code established equality before the law, protected private property, and restricted privileges based on birth or social class. This information is important to Napoleon's life story as it demonstrates his impact beyond military conquests, and his legacy in shaping modern legal systems.Source: "The Napoleonic Code," Britannica,

One of Napoleon's greatest military victories was the Battle of Austerlitz in 1805, also known as the Battle of the Three Emperors. Napoleon defeated a combined Russian and Austrian army, solidifying his power and expanding his empire. This information is important to Napoleon's life story as it highlights his strategic military abilities and his role in shaping the political landscape of Europe.Source: "Battle of Austerlitz," History.com,


sorry I cannot put links , this app doesnt allow it :(

Which of the following is NOT a way the British Parliament could have made the colonists happy?

Answers

Answer:

Giving the colonists self government

what was the name of the man who had a chance to shot Hitler during WW1 but did not

Answers

Henry Tandey
Henry Tandey became the most decorated private soldier in World War One. His bravery though, would be eclipsed in the run up to World War Two by allegations he had spared Adolf Hitler's life, in 1918.

what does bacon rebellion tell us about colonial slavery

Answers

The rebellion hastened the hardening of racial lines associated with slavery, as a way for planters and the colony to control some of the poor.

How did Elisha Hunt Rhodes able to justify the suffering endured by the Union troops?

Answers

The second half of 1862, 150 years ago, saw some momentous events in the life of Elisha Hunt Rhodes, a Civil War soldier from the village of Pawtuxet, Cranston, who entered military service for the Union in July 1861, as a private and left it four years later as a colonel.

Rhodes was delighted to obtain a commission as a second lieutenant, effective July 24, 1862. He was understandably proud of his achievement. On September 5 he noted in his diary that his brigade commander, Colonel Frank Wheaton, congratulated him on his promotion. “Well, I am proud, and I think I have a right to be, for 13 months ago I enlisted as a private and I am now an officer.” Two days later he indicated: “I am very happy over my promotion, for I am one of the youngest officers, being only 20 years old and seven months.”

Briefly describe one major difference between the lives of teenagers from 1939-1945 and the lives of teenagers from 1945 to 1955.

Answers

For much of the six years while Britain was at war (1939–1955), life was difficult for Londoners.

What changes occurred in the lives of English youngsters between 1939 and 1945?

Life was challenging for Londoners throughout the most of the six years while Britain was at war (1939–1955). There were rations on both food and clothing. The effects of bombing included fear, injury, death, and property destruction. Families were regularly split by evacuation and fathers going out to fight.

What changes have occurred during the 1940s?

Similar goods might be produced or acquired elsewhere at less money. Modern manufacturers perform the work with more machines than people thanks to new technology. Nowadays, there are more women working. Many women of young children manage to maintain a profession.

Learn more about new technology: https://brainly.com/question/21745576

#SPJ1

point
#5 Texas joined the side of the slave states in 1861. What was the name of
their country that lasted 4 years? *

Answers

Answer:

The name of the country was the Confederate States of America.

Explanation:

Yellow journalism used in a sentence

Answers

Answer:

Explanation: A newspaper headline like "ALIENS STEAL NEIGHBORHOOD PUPPIES"

Other Questions
two cars are heading straight toward each other, one going 20 m/s and the other going 30 m/s. when they are 250 m apart, each one brakes at 3 /2 . do they collide? "nor yet beside the rill,Nor up the lawn, nor at the wood was he;"(from "Elegy Written in a Country Churchyard" by Thomas Gray) When the Rent Expense account was reviewed, it was found that $800 of the rent had not been used and, therefore, should not have been expensed this year. What corrections, if any, should be made to the trial balance?Debit Column:Credit Column: Colligative properties are unique to solutions. select an answer and submit. for keyboard navigation, use the up/down arrow keys to select an answer. a. true b. false Which of the following are examples of integrity constraints? (Select all that apply, omit those that do not.) a) prevent the creation of an order for a nonexistant customer Ob) prevent a negative markup percentage c) prevent ordering zero pounds of raw materials from a supplier d) ensure that only authorized users have access to data e) ensure formatting includes decimal positions Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Determine which line passing through the given points has a steeper slope.Line 1: (0,5) and (6,1) Line 2:(-4,10) and (8,-5) When a market is internally efficient, it means that the market has a. price continuity. b. minimal transactions costs. c. more buyers than sellers. d. good depth be present and attentive: when you are talking to someone, make sure you are fully present in the moment and attentive to what they are saying. this shows that you are interested in them and their story. use active listening skills: listening actively involves not just hearing the words being spoken, but also paying attention to the tone, body language, and emotions of the person you are talking to. this helps you to better understand their perspective and build a connection. find common ground: look for shared interests or experiences that you have in common with the other person. this can be a great way to establish a connection and build rapport. ask open-ended questions: instead of asking closed-ended questions that require a yes or no answer, try asking open-ended questions that encourage the person to share more about themselves and their experiences. share something personal: sharing something personal about yourself can help to build trust and make the other person feel more comfortable opening up to you. use humor: humor can be a great way to break the ice and establish a connection with a stranger. just make sure to keep it appropriate and respectful. When KFC wanted to enter the Japanese market, it contacted Mitsubishi, one of Japan's largestpoultry producers. Mitsubishi provided an understanding of Japanese culture and some of the financing, while KFC provided the rest of the financing and its franchising expertise. The activities ofKFC and Mitsubishi took place in the ____ component of the task environment.(A) sociocultural(B) strategic partners(C) suppliers(D) competitors(E) economic What does the following definition describe? The division of an audience into groups of who they are and what they like, with a goal of identifying a group most interested in your product/service.- Marketing channels- Demographics- Audience segmentation- Group dynamics a drug that stimulates peristalsis in the stomach was injected into a human subject. electrical activity and contractile strength was measured in the stomach smooth muscle. the drug caused the stomach to contract three times per minute. compared to the period before drug injection, the period of intense contraction is characterized by historyWhat does it mean to do the history of science? How doeshistoricizing science change our view of what science is anddoes? what is the output from the following program? var groceries = { "bananas": 4, "apples": 5, "eggs": 12, "oranges": 1 }; function start(){ mystery("apples", "oranges"); println(groceries.apples); } function mystery(one, two){ var temp = groceries[one]; groceries[one] = groceries[two]; groceries[two] = temp; Required information Breach of Contract and Remedies When one party fails to perform as agreed, the Uniform Commercial Code (UCC) defines that fallure as a breach of contract and makes a distinction between a total breach and a partial breach. The UCC also provides recourse for the nonbreaching party to recover damages. The alternative recourses are known as remedies and certain relief is available for specific types of breaches. Roll over the item to read a hint about what type of damages best matches the item. Then click and drag each item to its correct category of damages. Prevents unjust enrichment Compensatory Fixed amount of damages Consequential Prevents unjust enrichment Restitution Actual damages suffered by nonbreaching party Liquidated Foreseeable indirect losses Fixed amount of damages Actual damages suffered by nonbreaching party Foreseeable indirect losses When household debt levels rise:a. the ability to get more credit rises.b. families are less able to spend in the current period.c. investment levels rise.d. tax payments will be higher.e. none of the above Suppose 30% of the restaurants in a certain part of a town are in violation of the health code. A health inspector randomly selects nine of the restaurants for inspection. (Round your answers to four decimal places.)(a) What is the probability that none of the restaurants are in violation of the health code?(b) What is the probability that one of the restaurants is in violation of the health code?(c) What is the probability that at least two of the restaurants are in violation of the health code? Using the different free editing applications such as Canva, Picsart, and SketchPad,create a Digital Poster wherein you can show the theme Promoting Southeast Asian Music. f a Tax Professional does not know what business code to enter for a taxpayer's sole proprietorship, they should __________. 8. Nathan is the administrative manager at Woodlands, Inc. The organizational procedures and policies of the company prevent Nathan from implementing many of his ideas to increase efficiency. This indicates a low degree of which reduces Nathan's ability to influence others (power) A. centrality B. discretion C. substitutability D. ingratiation E. visibility 9. Mathew is one of the top attorneys at his law firm. His brilliance in handling some of the most difficult and high-profile cases has earned him fame far and wide, and he wields considerable influence in the running of the firm. Mathew's high degree of ___ ensures that he has considerable power to influence others. A. internalization B. discretion C. substitutability D. ingratiation E visibility