The HOH molecule is bent, whereas the HBeH molecule is linear because the placement of the two sets of unpaired electrons in water forces the bonds to expect a tetrahedral arrangement, and the resulting HOH molecule is bent.
Why are molecules bent instead of linear?The presence of lone electron pairs in the central atom causes the bent structure of these molecules. Water, nitrogen dioxide, CH2, and other common bent molecules are listed below.
The primary distinction between linear and bent molecules is that linear molecules have atoms bonded together to form a straight molecule, whereas bent molecules have atoms arranged in a bent shape with an angle.
Thus, the oxygen atom, in addition to forming bonds with the hydrogen atoms, also displaces two pairs of unshared electrons.
To learn more about bent and linear, follow the link;
https://brainly.com/question/24775418
#SPJ1
which metal has highest melting point
Answer:
The metal with the highest melting point is tungsten, which has a melting point of about 3,410 degrees Celsius (6,170 degrees Fahrenheit). Tungsten is known for its high melting point and excellent resistance to wear and corrosion, which makes it a useful material in many industrial applications.
Other metals with high melting points include osmium (3,060 degrees Celsius), rhenium (3,180 degrees Celsius), and tantalum (2,996 degrees Celsius). These metals are also known for their excellent resistance to wear and corrosion, and are used in a variety of industrial and technical applications.
It is worth noting that the melting point of a metal can depend on the purity and crystalline structure of the sample, and can vary slightly from one sample to another. However, tungsten is generally considered to have the highest melting point of any pure metal.
A scientist collects a core sample from 60 km deep on Earth.
Which characteristic will she most likely observe in this sample?
Answer:
The sample has high iron content.
Explanation:
Hope This Helps
Have A Great Day
~Zero~
1. An Element is determined by the number of ________ and it’s nuclear ( Also known as atomic number).
2. Each chemical element is made up of only one kind of...
What is the energy of a photon with a 6 micrometer wavelength (1 m = 10^6micrometers)?
O 3 x 10-34 )
O 3 x 10-32
O 3 x 10-20 ]
O 3 x 10-20 j
The energy of a photon : 3 x 10⁺²⁰
Further explanationRadiation energy is absorbed by photons
The energy in one photon can be formulated as
\(\large{\boxed{\bold{E\:=\:h\:.\:f}}}\)
Where
h = Planck's constant (6,626.10⁻³⁴ Js)
f = Frequency of electromagnetic waves
f = c / λ
c = speed of light
= 3.10⁸
λ = wavelength
Wavelength of photon=λ=6 μm = 6.10⁻⁶ m
\(\tt E=h\times \dfrac{c}{\lambda}\\\\E=6,626.10^{-34}\times \dfrac{3.10^8}{6.10^{-6}}\\\\E=3.3\times 10^{-20}~J\)
0.444 mol C2H5OH= how many molecules
Explanation:
hope it make sense to u :)
what are items that are ferromagnetic material
Answer:
I'll give you three examples:
Iron
Cobalt
Nickel
Bill is experimenting with two simple machines. How will he know which
machine is more efficient?
O It will use less force to do the same amount of work.
O It will use more force to do the same amount of work.
O It will be lighter and stronger than the other simple machine.
It will not be possible to tell which simple machine is more efficient.
allocate the signals in the H NMR spectrum of
p-bromoaniline
The H NMR spectrum of p-bromoaniline typically exhibits several distinct signals corresponding to different hydrogen atoms in the molecule. Here is a breakdown of the expected signals in the H NMR spectrum of p-bromoaniline:
1. Aromatic Protons:
The aromatic ring in p-bromoaniline consists of four hydrogen atoms. These hydrogen atoms are typically observed as a multiplet or a set of closely spaced peaks in the region of 7.0-8.5 ppm. The exact chemical shift of these protons can vary depending on the specific substitution pattern and neighboring groups.
2. NH Proton:
The hydrogen attached to the amino group (-NH2) in p-bromoaniline appears as a singlet signal in the region of 5.5-6.5 ppm. This signal is often distinct and shows a characteristic downfield shift compared to the aromatic protons.
3. Other Protons:
p-bromoaniline may also have additional proton signals depending on the presence of other functional groups or substituents. For example, if there are alkyl groups present, their hydrogen atoms may appear as distinct signals in the region of 0.5-3.0 ppm.
It's important to note that the exact chemical shifts and splitting patterns observed in the H NMR spectrum can be influenced by various factors, including solvent, temperature, and neighboring functional groups. Therefore, it is always recommended to consult an experimental H NMR spectrum of p-bromoaniline for accurate signal assignment.
To learn more about, p-bromoaniline, click here, https://brainly.com/question/30978866
#SPJ11
I need help with this because I’m lost on how to do it?
Answer:
• Note that dissolving rate is known as solubility
• Increase in particle size:
Solids → Solubility increaseLiquids → Solubility remains constantGases → Not accounted for• Increase in temperature:
Solids → Solubility decreasesLiquids → Solubility increasesGases → Solubility increases [Graham's law]• Increase in concentration:
Solids → No effect Liquids → Solubility increasesGases → Solubility increases• Increase in agitation [ high water concentration ]:
Solids → No effectLiquids → Solubility decreasesGases → Solubility decreases\(.\)
Indium oxide contains 4.784 g of indium for every 1.000 g of
oxygen. In 1869, when Mendeleev first presented his version
of the periodic table, he proposed the formula In2O3 for indium oxide. Before that time it was thought that the formula was InO. What values for the atomic mass of indium are obtained using these two formulas? Assume that oxygen has an atomic mass of 16.00
The atomic mass of Indium obtained is 60.544 g
For every 1g of Oxygen 4.784 g of Indium Oxide
Atomic mass of oxygen, O2 = 16.00 g
Now,
For Indium Oxide,
Mass of oxygen present = 3*16.00 = 48.00 g
Mass of Indium Oxide = 4.784 g * 48.00 g = 229.632 g
Let atomic mass of Indium
Mass of Indium Oxide = 2*M + 3* 16.00 g
229.632 g = 2 * M + 48.00 g
2 M = 181.632 g
M = 181.632 g / 2
M = 90.816 g
For InO
Mass of oxygen present = 1* 16.00 g = 16.00 g
Mass of InO = 4.784 g * 16.00 g = 76.544 g
Let the atomic mass of Indium = M
Mass of InO = M * 1 g + 1*16.00 g
76.544 g = M + 16.00 g
M = 60.544 g
Hence the value obtained is 60.544 g
To know more about Indium Oxide here :
https://brainly.com/question/28294763?referrer=searchResults
#SPJ1
The oxidation of the hemoglobin molecule’s iron ions to the ferric state (fe ) results in?
The oxidation of the iron ions in the hemoglobin molecule to the ferric state (Fe³⁺) results in the loss of the molecule's ability to bind and transport oxygen.
This oxidation process alters the structure of hemoglobin, rendering it less effective in its primary function of carrying oxygen to body tissues.
Hemoglobin is a protein found in red blood cells that is responsible for transporting oxygen from the lungs to tissues throughout the body. It contains iron ions (Fe²⁺) that bind to oxygen molecules, forming a reversible complex known as oxyhemoglobin. This complex is crucial for oxygen transport.
However, when the iron ions in hemoglobin undergo oxidation to the ferric state (Fe³⁺), the binding affinity for oxygen decreases significantly. The oxidation can be caused by factors such as exposure to certain chemicals or reactive oxygen species. As a result, the oxidized hemoglobin is unable to efficiently bind oxygen, impairing its oxygen-carrying capacity and potentially leading to reduced oxygen delivery to tissues.
Learn more about oxygen here;
brainly.com/question/17698074
#SPJ11
what ocurrrs when the vapor pressure of a liquid is equal to the external atmospheric pressure
Answer:
The change from a liquid phase to a gaseous phase.
so the answer would be it changed to a gaseous phase
---------------
This is what occurs when the vapor pressure of the liquid is equal to the atmospheric pressure exerted on the liquid.
how many molecules are contained in 0.254 moles of diarsenic trioxide
Answer:
1.53 × 10²³ molecules As₂O₃
Explanation:
Step 1: Define
Diarsenic Trioxide - As₂O₃
Avagadro's number: 6.02 × 10²³ atoms, molecules, formula units, etc.
Step 2: Use Dimensional Analysis
\(0.254 \hspace{3} mol \hspace{3} As_2O_3(\frac{6.02(10)^{23} \hspace{3} molecules \hspace{3} As_2O_3}{1 \hspace{3} mol \hspace{3} As_2O_3} )\) = 1.52908 × 10²³ molecules As₂O₃
Step 3: Simplify
We have 3 sig figs.
1.52908 × 10²³ molecules As₂O₃ ≈ 1.53 × 10²³ molecules As₂O₃
Which statement about noble gases is correct? *
They are extremely rare in nature.
They are highly reactive with both metals and nonmetals.
O They exist as single atoms rather than as molecules.
O They form compounds with very bright colors.
Answer:
Hello There!!
Explanation:
I believe the answer is O They form compounds with very bright colors.
hope this helps,have a great day!!
~Pinky~
The statement about noble gases that is correct is D. They form compounds with very bright colors.
Noble gases simply refers to the elements that have similar properties. Noble gases are colorless, odorless, and have very low reactivity.
Examples of noble gases are helium, argon, Krypton, xenon, etc. Noble gases also form compounds with very bright colors.
In conclusion, the correct option is D.
Read related link on:
https://brainly.com/question/24070118
A neutral atom of Cobalt (Co) has an atomic number of 27 and an atomic mass of 59. Therefore, Co has _________________________
Answer:
A neutral atom of Cobalt (Co) has an atomic number of 27 and an atomic mass of 59. Therefore, Co has 27 electrons, 27 protons and 32 neutrons.
Explanation:
An atom consist of electron, protons and neutrons. Protons and neutrons are present with in nucleus while the electrons are present out side the nucleus.
All these three subatomic particles construct an atom. A neutral atom have equal number of proton and electron. In other words we can say that negative and positive charges are equal in magnitude and cancel the each other. For example if neutral atom has 6 protons than it must have 6 electrons. The sum of neutrons and protons is the mass number of an atom while the number of protons are number of electrons is the atomic number of an atom.
The atomic number Co is 27 it means it has 27 protons and 27 electrons.
The mass number is sum of protons and neutrons, thus number of neutrons are
59 - 27 = 32 neutrons
A student must make a buffer solution with a pH of 2.5. Determine which of the acids and conjugate bases listed below are the best options to make a buffer at the specified pH.
The final volume of buffer solution must be 100.00 mL and the final concentration of the weak acid must be 0.100 M. Based on this information, what mass of solid conjugate base should the student weigh out to make the buffer solution with a pH=2.5?
Weak acids:
a. sodium disulfate monohydrate, Ka =1.20 x 10^-2
b. phosphoric acid, Ka= 7.52 x 10^-3
c. acetic acid, Ka= 1.75 x 10^-5
d. formic acid, Ka= 1.77 x 10^-4
Conjugate bases:
a. sodium dihydrogen phosphate monohydrate Na2PO4* H20
b. sodium sulfate decahydrate Na2SO4* 10H20
c. sodium formate
d. sodium acetate trihydrate CH3COONa * 3H2O
The final volume of buffer solution must be 100.00 mL and the final concentration of the weak acid must be 0.100 M. Based on this information, what mass of solid conjugate base should the student weigh out to make the buffer solution with a pH =2.5?
.........grams
The best option to make a buffer solution with a pH of 2.5 is formic acid (Ka = 1.77 x 10^-4) and its conjugate base, sodium formate. The mass of solid sodium formate needed is 1.57 grams.
To determine the best acid and conjugate base pair for the desired pH, first use the Henderson-Hasselbalch equation: pH = pKa + log([A-]/[HA]).
Find the pKa of each weak acid by taking the negative log of their Ka values.
Formic acid (pKa = 3.75) is the closest to the desired pH of 2.5.
Next, calculate the ratio of [A-]/[HA] required for the buffer.
Use the equation to find [A-] = 0.0562 M.
Finally, calculate the mass of sodium formate: (0.0562 mol/L) * (100 mL) * (68.01 g/mol) = 1.57 grams.
Learn more about buffer here:
https://brainly.com/question/22821585
#SPJ11
Time left 1:45:17
Question 7
Not yet answered
Marked out of 3
Flag question
Question text
Consider the following reaction:
2Si2H6(g) + 7O2(g) ⇌ 4SiO2(g)+6H2O (l)
Give the expression for the equilibrium constant for this reaction. A. (PSi2H6)2(PO2)7/(PSiO2)4
B. (PSi2H6)2(PO2)7(PSiO2)4
C. (PSiO2)4/(PSi2H6)2(PO2)7
D. (PSiO2)4[(H2O])6/(PSi2H6)2(PO2)7
The equilibrium constant expression for the reaction is (PSiO2)4/(PSi2H6)2(PO2)7. Hence, the correct option is C.
In this expression, the concentrations of the reactants (Si2H6 and O2) are raised to the power of their respective stoichiometric coefficients, and the concentration of the product (SiO2) is raised to the power of its stoichiometric coefficient. The concentration of the liquid product (H2O) is not included in the equilibrium constant expression because it is in the liquid state.
The correct expression for the equilibrium constant (K) for the given reaction is:
C. (PSiO2)4/(PSi2H6)2(PO2)7
Therefore, the equilibrium constant expression for the reaction is (PSiO2)4/(PSi2H6)2(PO2)7.
Learn more about equilibrium constant from the link given below.
https://brainly.com/question/28559466
#SPJ4
What does this represent about the type of change
happening in the container?
Theresa creates an experiment where she mixes two
red-colored substances together in a container and
observes the solution slowly changing from red to blue
for the next eight minutes. The solution becomes
completely blue after eight minutes.
O A chemical change started immediately and finished
at eight minutes.
O A non-chemical change started immediately and
finished at eight minutes.
O A chemical change occurred at four minutes.
O A non-chemical change occurred at four minutes.
Answer:
A
Explanation:
A chemical change started immediately and finished at eight minutes
Answer:
The answer is
A.) A chemical change started immediately and finished
at eight minutes.
Explanation:
If you were to do a 50% serial dilution, starting with a 10% concentration, how many dilutions would you have to make before getting to 2. 5% as your final concentration?.
The number of dilutions required to reach 2.5% as the final concentration would be 2.
Any dilution in which the concentration is reduced by the same amount in each subsequent stage is referred to as a serial dilution.
In serial dilutions, the original volume divided by the final amount is known as the dilution factor.
\(DF = \frac{V_i}{V_f}\)
Now we are given that we must do 50% serial dilution, which indicates that the concentration must be reduced to half of its starting value after each dilution.
∴ \(DF=\frac{10}{50}\) × \(100\)
DF = 2
This indicates that starting with a 10% concentration, a single dilution would result in a 5% concentration. And again diluting this 5% concentration would result in a 2.5% concentration.
Hence, the number of dilutions required to reach 2.5% as the final concentration would be 2.
Read more about Serial dilution:
https://brainly.com/question/14660275
#SPJ4
In a steady flow combustion chamber , liquid enthyl alcohol ( C2H5OH(l)) at 25 degrees celsius (density : 790 kg/m^3; Specific heat at constant pressure: 114.08 kJ/kmol*K and enthalphy of vaporization: 42,340 kJ/kmol) is burned with 40 percent excess air that also enters at the same temperature as the fuel. combustion products leave thr chamber at 600K. Assuming a complete combustion. Determine the following:
A. The required volume flow rate of the liquid ethyl alcohol to supply at a rate of 2000kJ/s (answer should be in units of L/min)
The required volume flow rate of liquid ethyl alcohol to supply at a rate of 2000 kJ/s is approximately 164.9 L/min.
To determine the required volume flow rate of liquid ethyl alcohol, we need to calculate the fuel flow rate first. Then, we can convert it to volume flow rate.
Given:
Rate of energy release (Q) = 2000 kJ/s
Excess air = 40% (or 0.4)
First, let's calculate the fuel flow rate (m f):
Q = m f × Lower Heating Value (LHV)
The Lower Heating Value (LHV) for ethyl alcohol can be calculated using the enthalpy of vaporization:
LHV = enthalpy of vaporization / molecular weight of fuel
LHV = 42,340 kJ/k mol / 46.07 kg/k mol = 920.11 kJ/kg
Now, we can calculate the fuel flow rate:
m f = Q / LHV
m f = 2000 kJ/s / 920.11 kJ/kg ≈ 2.173 kg/s
Next, let's convert the fuel flow rate to volume flow rate:
Volume flow rate (V f) = m f / density
V f = 2.173 kg/s / 790 kg/m³ = 0.002749 m³/s
Finally, we can convert the volume flow rate to L/min:
V f = 0.002749 m³/s × (1000 L/1 m³) × (60 s/1 min) ≈ 164.9 L/min
Therefore, the required volume flow rate of liquid ethyl alcohol to supply at a rate of 2000 kJ/s is approximately 164.9 L/min.
Learn more about volume from the link given below.
https://brainly.com/question/24086520
#SPJ4
What mass of Barium Nitride can be theoretically produced?
Answer:
151.33 g/mol
Explanation:
TRUST ME -_-
Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).
I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.
Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG
mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG
Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG
(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop
write the equilibrium constant expression, k, for the following reaction taking place in dilute aqueous solution. hf (aq) oh- (aq)f- (aq) h2o (l) k =
The equilibrium constant expression, K, for the given reaction is as follows:
K = [F-][H2O]/[HF][OH-]
In this equation, the brackets indicate the molar concentrations of the respective species in solution. The numerator contains the concentration of the products, F- and H2O, while the denominator contains the concentration of the reactants, HF and OH-. The value of K will depend on the temperature and pressure conditions of the reaction, as well as the nature of the reactants and products involved.
Hi! The equilibrium constant expression, K, for the reaction HF(aq) + OH-(aq) ⇌ F-(aq) + H2O(l) in dilute aqueous solution can be written as:
K = [F-][H2O]/[HF][OH-]
However, since the concentration of water (H2O) remains constant during the reaction, it is usually omitted from the expression. Thus, the simplified equilibrium constant expression is:
K = [F-]/[HF][OH-]
This expression relates the concentrations of the reactants (HF and OH-) and the product (F-) at equilibrium, allowing you to determine the extent of the reaction in the aqueous solution.
To know more about aqueous solution visit-
https://brainly.com/question/26856926
#SPJ11
Wass, volume and density are all properties of
matter
3
weight.
formula
Answer:
:)
Explanation:
They are all properties of Matter. weight and formula wouldn't make sense.
What's the equation used to calculate how far a wave has traveled?
which substance is alkali
Answer:
Alkalis form chemical salts when they are combined with acids. e.g Sodium hydroxide ,Potassium hydroxide and Ammonia
Explanation:
Answer:
a substance which is alkali is a base that is soluble in water.an example is sodium hydroxide.
what's the rest?
Rb: [Kr]_s
Answer:
Rb: [Kr] 5S¹
Explanation:
Rubidium is the chemical element with the symbol Rb and atomic number 37.
Name the following cycloalkane:
CH2CH2CH2CH3
A. butylcyclohexane
B. butylcyclopentane
C. propylcyclohexane
Answer:
The answer for this question is A. butylcyclohexane
Explanation:
Choose letter A
You welcome have a nice day.
Name of the given compound is butyl cyclohexane.
What are cyclo alkanes?Cyclo alkanes are those organic compounds in which alkanes are present in the cyclic form.
In the nomenclature of cyclo alkane, name of the substitute is put before the name of the main ring. In the given structure number of carbons in ring is 6 so that given cycloalkane is cyclohexane and butyl group is attached as substitute. So name of the given compound is butyl cyclohexane.
Butyl cyclopentane is wrong because 6 carbons are present in ring.Propylcyclohexane is also wrong because 4 carbons are attached in the ring.Hence name of the compound is butyl cyclohexane.
To know more about cycloalkanes, visit the below link:
https://brainly.com/question/25058711
#SPJ2
Please hurry i really need it fast
The answers are here
In which figure does Colin do work?
A. Figure A
B. Figure B
C. Both figures
D. Neither figure
How many molecules of calcium chloride are in 3CaCl2