Answer:
By the sperm cell dividing or by 5 sperm cells enter the egg at the same time
Explanation:
One sperm cell can break down into two to or two sperm cell reach the egg at the same time resulting in either Identical twins (monozygotic) or Fraternal (dizygotic) so that theory explain in Quintuplets
True or false - DNA and RNA store heredity to make proteins?
in my own opinion I think it's false ..,
WHOEVER ANSWERS GETS THE BRAINLIEST AWARD
Plants and animals are the producers in an ecosystem. true or false
Answer:
false
Explanation:
plants make their own food
animals must find their food but do not produce it
What is the main source of nutrients for autotrophs?
Answer:
Most autotrophs use a process called photosynthesis to make their food. In photosynthesis, autotrophs use energy from the sun to convert water from the soil and carbon dioxide from the air into a nutrient called glucose.
The three particles that make up atoms are
Answer:
electrons, protons, neutrons
Explanation:
Answer:
Protons, Electrons, Neutrons
Explanation:
Protons and neutrons are in the center of the atom, making up the nucleus
and...
Electrons surround the nucleus (in cloud or ring form)
Protons: are positively charged
*Protons give the element its name, therefore if there is a change in protons then it is a new element
Electrons: are negatively charged
Neutrons: are neutral and not charged
*Protons and Neutrons give the atom its mass
*If the mass of the same element changes it is because of the neutrons and it called an isotope
There are many models to show you how an atom looks...
Plum Pudding Model, The Nuclear Model (I like to call it the jimmy neutron model because that's what the symbol looks like), Planetary Model, and Quantum Model
*The last two models (Planetary and Quantum) are used more in science class
*The Quantum Model (made by Erwin Schrodinger) is widely accepted and it is the most accurate model since 1926
*The Planetary Model (by Niels Bohr) is used in science class to help you see how electrons are on energy levels and how they move when they are " excited" or absorbs energy and when they lose energy
the vessel that receives blood from the head, neck, chest, shoulders, and arms is the
The vessel that receives blood from the head, neck, chest, shoulders, and arms is the superior vena cava.
The heart pumps blood to all parts of the body. Blood supplies oxygen and nutrients to the entire body and removes carbon dioxide and residual elements. As blood travels through the body, oxygen is consumed and blood becomes deoxygenated.
The superior vena cava is a large vein that returns deoxygenated blood from the upper half of the body back to the right atrium of the heart. Its function is to collect blood from the head, neck, chest, shoulders, and arms and transport it back to the heart for oxygenation and circulation.
Learn more about superior vena cava: https://brainly.com/question/13142475
#SPJ11
which phenotypic ratio is observed among the f2 offspring of two heterozygotes?
The phenotypic ratio observed among the F2 offspring of two heterozygotes is 3:1.
When two heterozygotes are crossed, meaning they have one dominant allele and one recessive allele for a particular trait, the resulting phenotypic ratio among their offspring is typically 3:1. This ratio is a characteristic of Mendelian inheritance patterns.
In Mendelian genetics, the dominant allele masks the expression of the recessive allele. Therefore, in a heterozygous cross, there are three possible genotypes: two dominant homozygotes (AA), one dominant heterozygote (Aa), and one recessive homozygote (aa). Among these genotypes, there are two phenotypes: individuals expressing the dominant trait and individuals expressing the recessive trait.
Since the dominant phenotype is observed in both the dominant homozygotes and the dominant heterozygote, the phenotypic ratio becomes 3:1. This means that approximately 75% of the F2 offspring will exhibit the dominant phenotype, while approximately 25% will exhibit the recessive phenotype.
To learn more about phenotypic ratio, here
https://brainly.com/question/14910077
#SPJ4
The guard cells in a plant's dermal tissue can change shape in order to open
and close tiny pores called stomata. This structure allows guard cells to
perform which function?
O A Allow the plant to flex and bend without injury
B. Prevent insects from attacking and eating the plant
O C. Expand in size to hold water, sugars, and lipids
OD. Control passage of gases and prevent excess water loss
D. Control passage of gases and prevent excess water loss.
Guard cells in a plant's dermal tissue are specialized cells that control the opening and closing of stomata, which are tiny pores on the surface of leaves that allow for gas exchange.
By changing their shape, guard cells can regulate the size of the stomatal pore and control the passage of gases such as carbon dioxide and oxygen, as well as regulate the loss of water vapor through the stomata. This is critical for regulating the plant's internal water balance and preventing excess water loss, especially in hot and dry environments.
Therefore, the correct answer is (D) Control passage of gases and prevent excess water loss.
To learn more about stomata click here :
brainly.com/question/14351755
#SPJ4
WHICH PART OF THE CARROT STORES THE EXTRA FOOD
Answer:
the roots do
and the carrots store food in their to live on all winter and in the summers a new plant grows from these roots
What is an important difference between mitosis and meiosis that explains
why sexually-reproducing organisms use meiosis to generate cells for
reproduction?
All that apply
1. The process of meiosis includes crossing over and independent assortment, which increases genetic diversity.
2. Meiosis generats haploid (n) Cells
3. Meiosis generates geneticslly unique cells.
4. Meiosis generates dipload (2n) cells
5. Meiosis generates geneticslly identical cells
The most important differences between mitosis and meiosis includes crossing over and independent assortment, genetically unique cells (Options 1 and 3)
What is meiosis?Meiosis is a special type of cell division characterized to increase genetic variation due to the emergence of recombination and independent separation of homologous chromosomes during this process.
In conclusion, the most important differences between mitosis and meiosis that explains why sexually-reproducing organisms use meiosis to generate cells for reproduction include the process of meiosis includes crossing over and independent assortment, which increases genetic diversity and meiosis generates genetically unique cells (Options 1 and 3)
Learn more about meiosis here:
https://brainly.com/question/8253366
#SPJ1
A species has homologous chromosomes. What does this say about the species?
A. It has alleles that control certain traits
B. It has pairs of matching chromosomes
C. Its a eukaryote and a haploid species
D. It has DNA that is made of of genes
Which of the following statements is true of non-homologous end joining (NHEJ)?
a. it is a double-strand repair pathway
b. it is error-prone
c. it utilizes the sister chromatid as a template for repair
d. it is error-free
e. both A and B
Statements that is true of non-homologous end joining (NHEJ) it is a double-strand repair pathway and it is error-prone.
In general ,Non-homologous end joining (NHEJ) is pathway that helps to repairs double-strand breaks in DNA. NHEJ is referred to as non-homologous as the ends are perfectly ligated and do not need a homologous template, while homology mediated repair(HDR), also requires a homologous sequence for guiding repair process.
Hence, NHEJ-break ends can be ligated without a homologous template, on the other hand HDR-breaks needs a template that guide repair. So , repair of chromosomal DSB through cell will be divided into two categories of repair pathways non-homologous end joining (NHEJ) and homology-directed repair (HDR).
To learn more about non-homologous end joining , here
brainly.com/question/13260028
#SPJ4
true or false mutation alone can cause rapid evolution
Answer:
true ig
Explanation:
The ability to think logically and clearly.
The ability to think logically and clearly is cognition.
The mental act or process of learning and comprehending through reason, experience, and the senses is known as cognition. It includes every facet of intellectual activity, including perception, thought, intelligence, knowledge development, memory and working memory, judgment and evaluation, reasoning and calculation, problem-solving and decision-making, comprehension, and language production. Because it involves imagining possibilities, imagination is sometimes regarded as a cognitive process. Cognitive processes both rely on and generate new knowledge. The term "cognition" is typically employed in psychology within an information-processing view of a person's psychological activities. The phrase is used to describe attitudes, attribution, and group dynamics in the study of social cognition, a subfield of social psychology.
If you want to know more about cognition visit the following link;
https://brainly.com/question/1686723
#SPJ4
Scientists think that dolphins and whales may have evolved from a
common ancestor. What evidence supports this hypothesis?
A) They swim the same way.
B) They have similar anatomies.
C) They live in the same area of the ocean.
D) They eat food the same way.
Scientists think that dolphins and whales may have evolved from a common ancestor because they have similar anatomies.
What is a common ancestor?A common means different animals now, have evolved from a single ancestor or animal.
These animals may share common characters and structures.
Whales, dolphins, and porpoises are evolved from a common ancestor; cetacean.
The animals that evolved from cetaceans are all aquatic, primitive cetaceans were amphibians too.
Thus, the correct option is B) They have similar anatomies.
Learn more about ancestors
https://brainly.com/question/8208618
Explain what the angel could symbolize to the activists and their mission in Fannie Lou Hamer Song
The angel in the Fannie Lou Hamer song could symbolize hope, inspiration, and guidance for the activists and their mission.
In the Fannie Lou Hamer song, the angel serves as a powerful symbol that holds significance for the activists and their mission. The angel can represent hope and inspiration, providing a sense of encouragement and motivation to the activists who are fighting for justice and equality. It symbolizes a guiding force that supports them in their endeavors and reminds them of the righteousness of their cause.
The angel may also represent the spiritual or moral aspect of the activists' mission. It embodies a higher purpose or divine presence, reminding them of the importance of their work and the values they are fighting for. The angel's presence in the song may serve as a reminder to stay strong and steadfast in their convictions, even in the face of adversity.
Overall, the angel symbolizes the activists' connection to something greater than themselves, instilling them with hope, inspiration, and a sense of purpose as they strive to bring about positive change in their society. It serves as a guiding light that guides and uplifts them on their mission towards justice and equality.
Learn more about guidance here: https://brainly.com/question/839980
#SPJ11
Name the tissue which makes up the skeleton
Answer:
Bone, cartilage, tendons, joints, and ligaments
Explanation:
Uh that's what the skeleton is made out of. Nothing I can really explain
Answer:
Tissue that gives strength and structure to bones. Bone is made up of compact tissue (the hard, outer layer) and cancellous tissue (the spongy, inner layer that contains red marrow). Bone tissue is maintained by bone-forming cells called osteoblasts and cells that break down bone called osteoclasts. Bones also contain blood vessels, nerves, proteins, vitamins, and minerals. Also called osseous tissue.
A quick anatomy of the bone! (extras)
Anatomy of the bone. The bone is made up of compact bone, spongy bone, and bone marrow. Compact bone makes up the outer layer of the bone. Spongy bone is found mostly at the ends of bones and contains red marrow. Bone marrow is found in the center of most bones and has many blood vessels. There are two types of bone marrow: red and yellow. Red marrow contains blood stem cells that can become red blood cells, white blood cells, or platelets. Yellow marrow is made mostly of fat.
Thank You!
Please mark me Brainliest!
Have a great day studying!
What would happen if no insects were resistant to insecticides?
Two of the most striking examples of resistant insect species are the Colorado potato beetle and the diamondback moth, both of which have developed extensive populations resistant to all synthetic insecticides registered for use against them, as well as biological insecticides like Bacillus thuringiensis.
Logging activities can improve the economy. However, if this activity is done without control, it can have a negative effect on biodiversity. Explain. *
Answer:
Logging can impact climate change by increasing the amount of free carbon dioxide in the atmosphere. Plant life stores carbon dioxide within its tissues. Deforestation often goes hand in hand with fire, which releases this stored carbon dioxide into the air, compounding the greenhouse gas effects.
Some suggestions for measures that the United States can implement to avoid contributing to greenhouse gases!
Answer:
1. Increase the use of green renewable energies
2. Promote recycling
3. Controlling industrial greenhouse CO2 emissions from the transportation sector
4. encourage the use of non-polluting means of transport (e.g., walking over road transport)
Explanation:
First, renewable energies are energy sources generated naturally without the use of fossil fuels (e.g., solar energy, wind energy, geothermal energy, etc). Thus, these green energies can replace the use of fossil fuels in a sustainable manner, and therefore reduce the emission of greenhouse gases such as carbon dioxide (CO2). Second, recycling can drastically reduce the amount of energy required to synthesize new products and reduces the need for new materials, being thus also useful to reduce CO2 emissions that result from extracting virgin materials. Third, the industries from the transportation sector produce the largest part of greenhouse gas emissions, thereby encourage the use of green energies in this area may represent a good alternative to reduce CO2 emissions. Finally, it is well known that urban transport generates about 40% of all CO2 generated by road transport, and thereby invest in green transport systems such as bicycling and walking may also represent a useful strategy to reduce CO2 emissions.
Climate change caused by natural disasters cannot have a negative impact on ecosystems. Please select the best answer from the choices provided T F
Answer:
FFFFFFFFFFFFFFFFF
Explanation:
trust i got it right on the test have a wonderful day :)))
how would i fill this out???
Answer:
Light Dependent
What goes In H2O (Water) *Light Energy
what goes out O2 (Oxygen)
where it occurs THYLAKOIDS
Light Independent
What goes In CO2 (Carbon Dioxide)
what goes out GLUCOSE
where it occurs STROMA
Jacob argued that enzymes are not reusable and function to slow down the rate of reactions.
Which statements show why Jacob's argument is incorrect? Select all that apply.
A
Enzymes are catalysts that speed up chemical reactions.
B
Enzymes increase the activation energy that is required for chemical reactions.
C
Enzymes are changed by the reaction and can be reused.
D
Enzymes are specific to the substrate to which they bind and can be reused.
E
All enzymes act on different reactions and by increasing the rate of the reaction.
Answer:
A
Explanation:
In living organisms, enzymes speed up the rate of chemical reaction by lowering the activation energy thereby bringing the reactants close to each other and weakened their chemical bonds which will enable the reactions to be faster.
Answer:
A
Explanation:
Functions of matured fresh egg of cat fish
Matured fresh eggs of catfish serve as the primary reproductive cells, capable of fertilization. They provide the genetic material necessary for the development of catfish offspring. These eggs are typically laid and incubated in a suitable aquatic environment until they hatch, ensuring the continuation of the catfish species.
Fertilization is the biological process by which the male and female reproductive cells, sperm and egg respectively, combine to initiate the development of a new organism. It typically occurs internally in most animals, including humans. During sexual reproduction, the sperm is introduced into the female reproductive system, where it travels to meet the egg.
The sperm then penetrates the egg, resulting in the fusion of their genetic material. This fusion forms a zygote, which is the initial stage of the new organism. Fertilization is a crucial step that combines the genetic information from both parents, determining the traits and characteristics of the offspring. It kickstarts a series of developmental events that eventually lead to the formation of a fully functioning individual.
To learn more about Fertilization visit here:
brainly.com/question/31097363
#SPJ4
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
How can urbanization affect a local area?
A. It can increase the number of invasive species in an area.
B. It can decrease the risk of water pollution in an area.
C. It can decrease the available habitats for wildlife in an area.
D. It can decrease the need for natural resources in an area.
Answer:
C. It can decrease the available habitats for wildlife in an area.
Why is DNA in the world?
Answer: Nine years ago I jumped at an opportunity to join the international team that was identifying the sequence of DNA bases, or “letters,” in the genome of the common chimpanzee (Pan troglodytes). As a biostatistician with a long-standing interest in human origins, I was eager to line up the human DNA sequence next to that of our closest living relative and take stock. A humbling truth emerged: our DNA blueprints are nearly 99 percent identical to theirs. That is, of the three billion letters that make up the human genome, only 15 million of them—less than 1 percent—have changed in the six million years or so since the human and chimp lineages diverged.
Evolutionary theory holds that the vast majority of these changes had little or no effect on our biology. But somewhere among those roughly 15 million bases lay the differences that made us human. I was determined to find them. Since then, I and others have made tantalizing progress in identifying a number of DNA sequences that set us apart from chimps.
An Early Surprise
The graphs below show the change in temperature and salinity of a region of ocean as an instrument is lowered below the surface. Depth is measured in kilometers below the surface, temperature in degrees Celsius, and salinity in parts per thousand.Image of two graphs. The left graph has the x-axis labeled temperature (degree C) ranging from 0 to 10. The y-axis is labeled depth below surface (km) ranging from -1.8 to 0. The line on graph goes up vertically starting at about 2 degree C on the x-axis and -1.9 km on the y-axis. The vertical line goes up staying at about 2 degree C and climbs from -1.9 km to about -0.8 km. The line starts to shift right at -0.6 km. The line shifts to the right from 2 degree C to 5 degree C. The line shifts to right more starting at -0.5 km and reaches 10 °C around -0.2 km. The line continues up vertically after -0.2 km. The right graph has the x-axis labeled salinity ranging from 33.8 to 34.6. The y-axis is labeled depth below surface (km) ranging from -1.8 to 0. The line on the graph starts at 34 on the x-axis and 0 km on the y-axis. The line starts to shift to the right at -0.1 km and levels out at 34.2 on the x-axis. At -0.2 km the line shifts to the left and continues to shift left until it reaches -0.5 km. The line starts to shift to the right again at -0.6 and continues to shift right until it reaches -1.9 km on the y-axis and 34.6 on the x-axis.© 2015 protonsforbreakfast.wordpressWhat is the most valid conclusion regarding ocean salinity based on the data?Ocean salinity is not related to water temperature.Ocean salinity changes with depth at a steady rate throughout the entire water column.Ocean salinity increases as ocean temperature decreases.Ocean salinity is more stable at higher temperatures than at lower temperatures.
Answer:
Ocean salinity increases as ocean temperature decreases.
Explanation:
Answer:Ocean salinity increases as ocean temperature decreases.
Explanation:
Jaime and Ryan first noticed that something was wrong with their newborn baby about four months after birth. Their baby seemed to be having difficulty holding her head up. After a series of tests, it was noticed that fatty acids were not being digested by the cells and were accumulating on the child's nerve cells. Which organelle is not properly functioning in the cells of Jaime and Ryan's newborn baby?
Answer:
Liver
Explanation:
The liver is an organelle in the human body that is responsible for the digestion of fat. Liver produces bile, a digestive juice that helps in the digestion of fats and vitamins. Bile juice is stored in the gall bladder and move into the small intestine for the digestion of fat.
As per the details in the question, a newborn baby is unable to digest fat which is affecting the child's nerve cells. It means the newborn baby's liver is not functioning properly and not making bile juice that can digest the fat properly.
Hence, the correct answer is "Liver".
Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base.
Original DNA gene: GATCGATACCATTCGGCGCATACTTCG
A)The mutated DNA sequence; highlight the insertion mutation.
B)The resulting MRNA sequence for each mutation:
C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this):
Note: Begin translation at the first start codon, AUG, that you see when reading the MRNA sequence from left to-right. Stop translating the sequence when you reach first stop codon in the reading frame.
Answer:
its b
Explanation:
A P E X verified
QUESTION 3: What conditions may occur when a population is inexponential growth?
A. birth rate is greater than death rate
B. birth rate is less than death rate
C. immigration rate is greater than emigration rate
D. immigration rate is less than emigration rate
Answer:
A. birth rate is greater than death rate
Explanation:
Hope this helps!
Answer:
a
Explanation:
N diploid wildflowers from a very large population are transplanted to a location in which they are reproductively isolated from the source population. Their heterozygosity is measured every generation. After 20 generations of random mating (and a constant number of offspring in each generation, N ), the heterozygosity of the isolated wildflowers is half of what it was at the start. What is your best guess of the value of N ? (Hint, if x≈0, then ln(1+x)≈x.) 3) a) A population with discrete generations experiences occasional surges and crashes in population size. In a fraction of generations r the population size is N
1
, and in the remaining 1− r generations the population size is N
2
. Adapt the formula for N
e
with varying population size,
N
1
1
+
N
2
1
+⋯+
N
k
1
k
(for k generations, with N
j
the population size in generation j ) to write an expression for the long-term effective population size of the population assuming that it meets all other Wright-Fisher assumptions. b) In the scenario in part (a), compute the effective population size if N
1
=1000, and N
2
= 1,000,000, and r=0.5. Repeat the calculation changing r to .1 and .01.
N = 1.386 Ne. and the value of N is a little over 100. After 20 generations of random mating, the heterozygosity of the isolated wildflowers is half of what it was at the start. The effective population size formula that can be used is N e = (1/2H) 2N / (2NH - H).
According to the given statement, Diploid wildflowers from a large population are transplanted to a location where they are reproductively isolated from the original population. Their heterozygosity is measured each generation. After 20 generations of random mating, their heterozygosity is half of what it was at the start. The value of N must be estimated. We know that the effective population size is the size of the population that would have the same rate of genetic drift as the actual population.
The effective population size (N e) can be expressed as shown below:
Ne = 4N 1 N 2 / (N1 + N 2) In this formula, N 1 and N 2 are the number of organisms in the two populations.
Thus, after 20 generations of random mating, the heterozygosity of the isolated wildflowers is half of what it was at the start, indicating that: Heterozygosity after 20 generations = 1/2
Heterozygosity at the start or Heterozygosity at the start = 2 (Heterozygosity after 20 generations). The effective population size formula that can be used here is:
Ne = (1/2H) 2N / (2NH - H) Where H is the heterozygosity at the beginning and N is the effective population size.
We can use the Hint given in the question to find that the above equation is approximately:
Ne = (1/4) N/ ln (2) So, N/ ln (2) = 4Ne or N = 4Ne ln (2) ≈ 1.386NeThus, N ≈ 1.386Ne.
The value of N is a little over 100, which is what we can expect.
After 20 generations of random mating, the heterozygosity of the isolated wildflowers is half of what it was at the start. Therefore, the effective population size formula that can be used is N e= (1/2H) 2N / (2NH - H).
Thus, N ≈ 1.386 Ne. and the value of N is a little over 100.
To know more about heterozygosity visit:
brainly.com/question/31480023
#SPJ11