fter the opening phrase is sung by one person, other voices enter and sing together. what describes the relationship among the voices (the texture)?

Answers

Answer 1

The relationship among the different voices describes that the highest elevated voice sings the tune and the others orchestrate with it: all voices change syllables simultaneously.

A voice type is a gathering of voices with comparative vocal reaches, fit for singing in a comparative tessitura, and with comparative vocal progress focuses. Voice grouping is generally firmly connected with European traditional music, however it, and the terms it uses, are utilized in different styles of music too.

A vocalist will pick a collection that suits their voice. A few vocalists like Enrico Caruso, Rosa Ponselle, Joan Sutherland, Maria Callas, Jessye Norman, Ewa Podleś, and Plácido Domingo have voices that permit them to sing jobs from a wide assortment of types; a few artists, for example, Shirley Verrett and Elegance Bumbry change type and even voice part over their professions; and a few artists, for example, Leonie Rysanek have voices that lower with age, making them cycle through types over their vocations.

A few jobs are difficult to group, having exceptionally surprising vocal necessities; Mozart composed a considerable lot of his jobs for explicit vocalists who frequently had wonderful voices, and a portion of Verdi's initial works set outrageous expectations for their vocalists.

To know more about voices,visit here:

https://brainly.com/question/12284497

#SPJ4

(Complete question) is:

After the opening phrase is sung by one person, other voices enter and sing together. What best describes the relationship among the voices (the texture)?

Palestrina, Gloria, from Pope Marcellus Mass

0:38


Related Questions

what strategies used in arts education activities have been found to helpful in strengthening long-term memory?

Answers

In arts education activities, several strategies have been set up to be helpful in strengthening long- term memory.

One effective strategy is multisensory engagement, which involves incorporating visual, auditory, and kinesthetic rudiments to enhance memory retention. By engaging multiple senses simultaneously, learners can support their understanding and retention of information. Another strategy is active participation, where individuals diligently produce art or share in performances.

This requires critical thinking and decision- making, leading to stronger connections in the brain and enhanced long- term memory. The emotional connection fostered by arts activities can enhance memory formation and retrieval. By evoking emotions and particular connections, learners are more likely to form lasting recalls of the content they engage with.

To learn more about Strengthening long term memory:

https://brainly.com/question/24984032

#SPJ4

2
There were many large stone monuments that were created in the Neolithic period. What term would you use to identify one of these rocks?
OA. cromlech
О в.
C.
D.
menhir
monolith
dolman


Please help me me out I’ll give u 5 stars to the pl1st person who gives me the answer

Answers

Answer:

menhir

Explanation:

menhir upright stone that may have inscriptions

monolith is a large stone block for religious purposes

cromlech = circle

dolmen looks like the symbol : π

chatGPT

HURRY PLS WILL GIVE MAX POINTS PLUS BRAINLISWhen calculating the cost of items that do not come in neat, little units, you must use the item cost, the serving size, and what else to calculate the cost of that ingredient?


servings per container


servings per pallet


processing time


nutritional macros

Mark this and return

Answers

When calculating the cost of items that do not come in neat, little units, you must use the item cost, the serving size, and "servings per container" to calculate the cost of that ingredient.

When ingredients are purchased in bulk or come in irregular sizes, it can be challenging to determine the cost of the amount of the ingredient needed for a recipe. To calculate this cost, you need to know the item cost, which is the cost of the ingredient per unit of measurement, such as per pound or per ounce.

You also need to know the serving size of the ingredient, which is the amount used in the recipe, and the number of servings per container. The servings per container help you determine how many servings you can get from one container of the ingredient, and it's an essential factor to consider when calculating the cost of an ingredient.

To know more about cost of items , click here.

https://brainly.com/question/31444839

#SPJ1

Daniel Tammet uses the
word symmetrical to describe how he
envisions squared numbers. The word
symmetrical ends with the Latin suffix -
ical, which means "having to do with,"
"made of," or "characterized by." Find
other words in the selection that have
this suffix. Use a dictionary to verify the
precise meanings of these words.
.

Answers

I think you can get away with used as

in fat pig, the last image the audience sees in the play is tom and helen ___.

Answers

In the play "Fat Pig" by Neil LaBute, the final image that the audience sees is of Tom and Helen walking down the street hand in hand.

This scene is a powerful one as it brings together the play's central theme of body shaming and society's narrow beauty standards. Throughout the play, Tom has been struggling with his attraction towards Helen, a plus-size woman, while also dealing with the societal pressures to conform to a certain body type. In the end, Tom chooses to embrace his feelings for Helen and reject the societal expectations that have been placed on him. The image of Tom and Helen walking hand in hand is a hopeful one as it signifies a rejection of societal norms and the acceptance of oneself and others. It also symbolizes the possibility of love and connection despite societal pressures and judgments. LaBute's play sheds light on the damaging effects of body shaming and the need for society to embrace diversity and accept people for who they are, rather than conforming to narrow beauty standards. Overall, the final image in "Fat Pig" is a poignant one that leaves a lasting impression on the audience.

for more such questions on image

https://brainly.com/question/25729154

#SPJ11

The vocabulary word meaning to change is _____.

Answers

Transform is a synonym for change??

Explanation:

transform, transmute, modify

Alll of them are meaning to change.

what do we call a musical structure in which the theme (melody) is introduced and is then followed with statements of that theme that vary in some way (often by tempo, dynamics, etc.)?

Answers

The name of the musical structure in which the theme (melody) is introduced and is then followed by statements of that theme that vary in some way (often by tempo, dynamics, etc.) is called Theme and Variations.

A musical instrument is defined as a tool or device used to produce musical sounds. A musical instrument's sound can be produced by various means, including vibration, electronic, and acoustic means.

A melody is a sequence of single pitches that are arranged in a rhythmical pattern to create a tune. It is the most identifiable part of the song and is usually what is remembered after the song has ended. Melodies can be simple or complex and can be created in various ways by combining different notes and rhythms.

A theme is a recurring musical element in a composition.

It can be a melodic, harmonic, or rhythmic element that is repeated throughout the composition. A theme serves as a foundation for the rest of the composition and is often the most memorable part of the piece.

In classical music, a theme is typically introduced in the first movement of a sonata or symphony and is then developed and elaborated upon in subsequent movements.

To learn more about Theme and variation refer - https://brainly.com/question/3583811

#SPJ11

while serving as conductor of the respected gewandhaus orchestra of leipzig, germany, which famous piano virtuoso did mendelssohn hire to collaborate with the orchestra in the performance of more than twenty concerts?

Answers

Examined are Felix Mendelssohn Bartholdy, Kapellmeister, and Thomaskantor Moritz Hauptmann. In order to steer the Gewandhaus orchestra away from light, popular music and toward artistic, canonical compositions, Mendelssohn was hired in 1835.

Mendelssohn made arrangements for his buddy Hauptmann to take over as Thomaskantor after Christian Theodor Weinlig passed away in 1842. Church music shifted in this stylistic direction because Hauptmann shared Mendelsson's perspective on canonical composition.The chapter ends by stating that the concert format Mendelssohn preferred as director of the Gewandhaus, consisting of lighter fare in the first half (often involving a soloist), an intermission, and a complete symphony or other major work in the second half, served as the inspiration for classical concerts as we know them today.This is the third of three chapters that examine the interaction between a Kapellmeister, who managed the public concerts, and a Thomaskantor, who was in charge of the church music.

learn more about Mendelssohn  here:

https://brainly.com/question/14929893

#SPJ4

2ways people use art and music in an art job

Answers

Answer:

Artists and musicians create works that not only unlock emotions, but also alter one's mood, trigger memories, and act as a source of comfort and inspiration. Visual art and music have numerous parallels because they share elements such as harmony, balance, rhythm, and repetition

Explanation:

which one of the following composers belonged to the middle ages or medieval time period? question 17 options: martin luther guillaume de machaut william kemp giovanni pieruigi da palestrina

Answers

Answer:

The polyphonic music of the church merged with the poetic art of the troubadours, and the two most important composers of the age were the blind Florentine organist Francesco Landini and the French poet Guillaume de Machaut, canon of Reims.

Explanation: just took the test

50 POINTS!!! What is a staff musician?

Answers

Answer:

In Western musical notation, the staff or stave is a set of five horizontal lines and four spaces that each represent a different musical pitch or in the case of a percussion staff, different percussion instruments.

Explanation:

Answer:

The music staff is the foundation for music notation, consisting of a set of five horizontal lines and the four spaces that are between the lines. The term "staff" is more common in American English and "stave" is used in British English, but the plural in both instances is "staves."

Explanation:

Does matrix resurrections have a post credit scene?

Answers

Answer:

Yes there is!

Which shutter speed will allow the most light to expose the light-sensitive chip in
the camera?
4 seconds
1 second
1/125 second
1/4 of a second

Answers

Answer: 1/125

Shutter speeds are measured in fractions of a second, such as 1/60, 1/125, 1/250, 1/500, and 1/1000. The longer the shutter speed, the more light; the shorter the shutter speed, the less light. An average shutter speed that would produce a good photograph taken in sunny conditions is 1/125 of a second.

Explanation:

A texture in which two or more different melodic lines are combined is called
a. monophonic.
b. homophonic.
c. polyphonic.

Answers

Answer:

C. polyphonic

Explanation:

polyphony, in music, the simultaneous combination of two or more tones or melodic lines

Which civilization had many city-states and dominated many areas of Central America from the 1300s to the 1500s?
O A Aztec
O B.
Mayan
O C.
O D. Olmec
Inca

Answers

Answer:

The Aztec

Explanation:

The Aztecs (/ˈæztɛks/) were a Mesoamerican culture that flourished in central Mexico in the post-classic period from 1300 to 1521.

in the arts, what are the characterisctic of a

Characteristic of japanese wood carving in ancient time

Answers

Answer:

The sculpture of Japan

Explanation:

HELP I NEED HELP ASAP
HELP I NEED HELP ASAP HELP I NEED HELP ASAP
HELP I NEED HELP ASAP HELP I NEED HELP ASAP
HELP I NEED HELP ASAP

A technique of shading so that there is a smooth and gradual transition from one value to the other.

A. Value
B. Stippling
C. Blending
D. Hatching

Answers

I think the answer is C) Blending!! Let me know if this helps!!

What can I Improve?What needs work?

I’m doing a poetry unit in English mixed with Romeo and Juliet and was inspired to rewrite a poem I wrote awhile ago it’s still a rough draft but I need help making it flow better and I wanted to run it by the awesome answerers on Brainly.
It’s a little personal to me but I hope the reader (you) will be able to understand it which is why I need critiquing.Please give me your honest feedback on it.
Also it may be a little depressing and overly sappy just a warning in advance.

Here it is:

E/N

To everybody and nobody who has been everything and nothing to someone.

Her eyes a changing green
Lower my self esteem
The smile she wears
Shows she cares
For me
But all I see
Is that while holding my hand she is uneasy
So under my breath I recite her poetry
To calm her mind
And with my reciting I find
That I’m nervous
Even though we know these stares can’t hurt us
They’re wearing us thin
Getting beneath our skin
Making me realize her heart is not mine to win
Because she’s my original sin
Everyday I can’t suppress the heartfelt feelings within
So I tell her everything
And to this fickle hope I cling
That she’ll stay with me
But I notice how he stares at her in class
And how she just waits for his gaze to pass
With a smile on her face
That should but fails to be out of place
She shatters my heart
Yet I don’t want to be apart
From her
So the days became clouded and blurs
And the voices I hear become slurs
And when asked if we are together
She just laughs it off and said we’re birds of a feather
But they still ask what I am to her
So I assure
That we’re friends
But that all depends
On her feelings
And whether they reopen my scars
And leave me bleeding
While we look up at the stars
Imagining we are everything
When we feel like nothing
When the numbness sets in
When the cruelty wins
When people question who we are to each other
I’ll say you’re nothing and everything to me
Just like the stars and are feelings both a glimmer of hope
But easily explode and go up in smoke
You are everything and nothing
For being my everything and nothing
I forgive you for not blushing when I tried being romantic
I forgive you for crushing on a complete lunatic
I forgive you for doing and being everything and nothing
Forgive me now for letting you be something
When to you all I could ever be is just another human being
That you’d use and abuse
And trick with your ruse
Like these other beings you’d tell me what I couldn’t hear
When you meant nothing behind it except fear
Fear for them knowing what you were like inside
Fear for them knowing the secrets you hide
Yet for years I stayed loyal by your side
I gained your trust and my trust you never even tried
Tried to gain my feelings that were nothing to you but something to me
So thank you for making me feel everything but empty
And helping me see the who I am, the real me.

From your friend, Everything and Nothing.

Answers

Answer:

spell check I have noticed a couple spelling issues and as I read through I see that your focusing strictly on the love aspect while you should focus on more of a variety that revolves on the subject of love, try perhaps relating your love with animals or adding other elements into the poem

Explanation:

Important rock-and-roll artists in the 1970s and 1980s included which of the following?
O A. Artie Shaw
O B. Bob Dylan
O C. Elvis Presley
O D. None of the above

Answers

Important rock-and-roll artists in the 1970s and 1980s included O D. None of the above.

The term rock 'n' roll derives from the more literal "rocking and rolling", a phrase used by seventeenth-century sailors to describe the motion of a ship on the ocean. Any word that is used to signify rhythmic motion of this kind - mainly with the aid of lonely seamen - runs the hazard of being purloined as a euphemism.

Rock and roll (frequently written as rock & roll, rock 'n' roll, or rock 'n roll) is a genre of popular track that evolved within the u.S. At some point in the late Forties and early Fifties. It originated from African-American tunes including jazz, rhythm and blues, boogie-woogie, and gospel, in addition to united states of America songs.

Chuck Berry did in truth invent rock'n'roll. Of route, comparable music would have sprung up without him. Elvis become Elvis before he'd ever heard of Chuck Berry. Charles' proto-soul vocals and Brown's everything-is-a-drum were improvements as profound as Berry's.

Learn more about rock-and-roll here https://brainly.com/question/3508939

#SPJ1

Answer:

bob dylan

Explanation:

HURRRRYYYYY!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Which qualities does an Interactive Media worker need when creating video conference or other multimedia projects for customers?

ability to keep secrets and information private
leadership and motivational skills
creativity for developing ideas and designs
knowledge of how to set up databases

Answers

Answer:

try answering with option c.

Explanation:

i'm pretty sure that is the right answer. i hope it is.

Answer:

Is there an all of the above option? Overall i think they need creativity for developing ideas and designs and knowledge of how to set up databases for their multimedia project.

Explanation:

I have done this once and trust me u need all of them.

Question 13 6.25 Points Destructive communication can be escalated by why type of communication? A
Dependency communication B Supportive communication C Neutrality communication D Defensive communication

Answers

Answer:

sameeeee

Explanation:

hereeee

frrrrrrreeeeeeeeeeeeeee brainliest!!!!

Answers

Answer:

THANKS

Explanation:

1 + 1 = 2

AHH HAPPY THANKSGIVING

Blockbusters typically follow a strategy of ____, a distribution strategy that involved opening the film simultaneously on a large number of screens. Jaws is generally acknowledged to be the first mainstream film to used this distribution strategy.

Answers

Blockbusters frequently use saturation booking, a distribution technique that involves releasing the movie simultaneously on lots of screens.

- When a new movie is released simultaneously, a phenomenon known as saturation booking, sometimes known as a saturation release, occurs. On the same day, in numerous cinemas across every market in the nation. Booking saturation occurs rather regularly, as well.

- A saturation release, sometimes known as saturation booking, denotes a strategy for simultaneously releasing a movie in several markets, possibly all of the markets in the nation. There is a massive marketing and advertising effort running in conjunction with the release.

To know more about saturation booking, kindly click on the link below :

https://brainly.com/question/1978746?referrer=searchResults

#SPJ4

Which of the following describes the elements of art in Yinka Shonibare's Nelson's Ship in a Bottle?
A. The bottle has a smooth texture.
B. The sculpture is a replica and is realistic.
C. The subject is a ship inside a glass bottle.
D. The work is a three-dimensional sculpture.

Answers

A I think. The bottle has a smooth texture

"The bottle has a smooth texture" describes the elements of art in Yinka Shonibare's Nelson's Ship in a Bottle. Thus, option 'A' is the correct option.

How does Yinka Shonibare describe his art?

It is possible to categorize Shonibare's art as multicultural because he incorporates components from several civilizations into his pieces. You might argue that he would choose to celebrate one of either side in his works as a British-African artist. But the fact that his art celebrates and critiques both British colonial history and African history is what makes it so intriguing.

According to Kuiper (2015), Shonibare's work frequently comprises "ironic drawings, paintings, sculptures, photos, videos, and installations," the majority of which include his defining component: Dutch wax-printed cloth. The Netherlands is where this fabric's vivid hues were inspired by Javanese textiles. The Dutch and the English recognized an opportunity to produce these textiles in large quantities across Europe by automating the dying process using new technology.

Learn more about Yinka Shonibare here:

https://brainly.com/question/25283283

#SPJ2

Which events were occurring at the same time? Check all that apply.

Pope tried to help the bicycle gain popularity.
Pope attempted to get cycling recognized as a real means of transportation.
Pope got involved in the arrest of three cyclists for defying cycling rules.
Pope spoke out against bicycling.
Pope accidentally crashed into a horse-drawn buggy.

Which events were occurring at the same time? Check all that apply.Pope tried to help the bicycle gain

Answers

Pope got involved in the arrest of three cyclists for defying cycling rules.

Pope tried to help the bicycle gain popularity.

Pope attempted to get cycling recognized as a real means of transportation.

__________________ are one of the ways identified that theatre artists cross national boundaries to work with artists in host communities.

Answers

Theatre collaborations are one of the ways identified that theatre artists cross national boundaries to work with artists in host communities.

Collaborations in theatre involve the pooling of resources by artists and organizations with the purpose of creating new work or to create work that is responsive to community needs. It is usually a cross-border and cross-disciplinary exchange that explores different cultures, languages, and theatrical practices.

The collaborations have numerous benefits, including a wide range of opportunities for artists to work outside their home countries, the development of innovative and responsive theatre practices, and opportunities for sharing knowledge and skills between artists.

Additionally, they help to build cultural bridges, facilitating intercultural dialogue and understanding. In the context of globalization and an increasingly interconnected world, theatre collaborations have become a crucial component of artistic practice in many regions of the world.

In recent years, international collaborations have been facilitated by the ease of communication and travel. Theatre collaborations have thus become one of the most effective ways for theatre artists to cross national boundaries to work with artists in host communities.

For more such questions on theatre  visit:

https://brainly.com/question/30257791

#SPJ8

Pursuit of Happiness-- (From movie)

1. Give two examples from the movie of each type of stroke. Explain your thinking for each and identify the impact of each example on the relationships in the movie.

2. Identify characters from the movie that illustrate each life position. What cues are you using to make your decision? (8 marks)

I’m Okay, You’re Okay-
I’m Okay, You’re not Okay-
I’m not Okay, You’re Okay-
I’m Not Okay, You’re not Okay-

Answers

1. To answer the first part of the question, you should identify different types of strokes and explain how they are portrayed in the movie "Pursuit of Happiness." Two examples of each type of stroke could be:

a. Positive strokes: These are affirmations or expressions of appreciation that enhance relationships. For example, in the movie, a positive stroke could be when a character expresses gratitude or compliments another character's accomplishments. The impact of positive strokes is usually positive, as they strengthen relationships and build trust.

b. Negative strokes: These are critical or judgmental remarks that can harm relationships. An example of a negative stroke in the movie could be when a character criticizes or belittles another character's abilities. Negative strokes can have a negative impact on relationships, causing tension or distance between individuals.

2. In terms of life positions, you should identify characters from the movie who exemplify each position and explain the cues you are using to make your decision. Here are the four life positions and some cues to consider:

a. "I'm Okay, You're Okay": This life position reflects a healthy and positive outlook on oneself and others. Characters who exhibit empathy, understanding, and collaboration could be seen as having this life position. Look for cues such as characters who are supportive, open-minded, and willing to cooperate.

b. "I'm Okay, You're not Okay": This life position implies a sense of superiority or judgment towards others. Characters who display arrogance, dismissiveness, or a lack of empathy might exemplify this position. Pay attention to cues such as characters who consistently belittle or devalue others.

c. "I'm not Okay, You're Okay": This life position reflects a lack of self-confidence or self-worth, while perceiving others as superior. Characters who exhibit insecurity, self-doubt, and dependence might align with this life position. Look for cues such as characters who constantly seek approval or rely heavily on others.

d. "I'm Not Okay, You're not Okay": This life position suggests a negative outlook on oneself and others. Characters who display pessimism, hostility, or a general distrust of others could be representative of this position. Pay attention to cues such as characters who are consistently critical, resentful, or isolating.

Learn more about stroke visit:

brainly.com/question/26482925
#SPJ11

is Detritus by Morgan Nomura a painting

Answers

Answer:

yes it's a famous art piece take a look at it on Google

Yes it is you can find it on google along with other great paintings

Match the dynasty or vocab! Please help me with this!

Match the dynasty or vocab! Please help me with this!

Answers

Answer:

white is mourning

jade is ming

Bronze chou

burial pottery is tang

yellow brown blue and green details are

cobalt blue under blue glaze is porcelain

light red burnished is the han

Explanation:

hope this helped

Answer:
white is mourning jade is ming Bronze chou burial pottery is tang yellow brown blue and green details are cobalt blue under blue glaze is porcelain light red burnished is the han.

identify what is notes on a piano c

Answers

Notes on a piano are organized into a scale that goes from A to G, with accidentals for notes outside of this scale. For example, C# would be a note outside of the A to G scale.

On a piano, notes are the fundamental elements of music. They are the building blocks of melodies, harmonies, and rhythms. The piano is a keyboard instrument that generates sound when a key is pressed, activating a hammer that strikes a string. When the string vibrates, it produces sound.

Each key on the piano keyboard corresponds to a particular note. There are a total of 88 keys on the modern piano, with each key representing a distinct note. The notes are organized into octaves, which are groups of eight notes that repeat up and down the keyboard.

Piano notes can be identified by their names. The notes are named after the first seven letters of the alphabet: A, B, C, D, E, F, and G. These letters are repeated over and over again as you move up and down the keyboard. Each note has a different pitch, which refers to how high or low the sound is.

In addition to the letters, each note is also assigned a number to indicate its position on the keyboard. Middle C, for example, is the note that is located at the center of the keyboard, right in the middle of the piano. It is called C4, indicating that it is the fourth C on the keyboard.

In summary, notes on a piano are the building blocks of music. They are identified by their names, which are based on the first seven letters of the alphabet, and their position on the keyboard, which is indicated by a number. The piano keyboard is organized into octaves, with each octave consisting of eight notes that repeat up and down the keyboard.

For more such questions on Notes of piano.

https://brainly.com/question/30766398#

#SPJ11

Other Questions
-3-2449(-2,-2)2A(2, 2)23The distance of AB = [? ]Round to the nearest tenth.Hint: d= (x 1 ) + (Y2 Y1)Enter At a weightlifting competition two competitors list of the same way to the same height the second competitor accomplished to live two seconds faster than the first competitor this demonstrates that the second competitor had one more In Freuds theory which of the following is the center of conscious awareness in the personality that gives the individual the cognitive powers of judgment, memory, perception, and decision making?a. Idb. Superegoc. Libidod. Ego on an annual basis, the per capita electricity usage in ethiopia is approximately what percent of the per capita electricity usage in the united states? Which substance is the reducing agent in the reaction below?Pb+PbO2 +2H2 SO4 (R) 2PbSO4+ 2h2OA) PbB) H2SO4C) PbO2D) PbSO4E) H2O Okay, how many weeks would you have to work to pay for Garys $1200 mistake? Which perspective stipulates that the constitution's drafters were guided less by cultural values, rather, they were looking for organizational arrangements that would regulate political behavior? I need helpppp with 1-9 identify a material that was used for all exposed parts of athena's body in the statue housed in the cella of the parthenon. Solve the following inequality, 8 < 2(7-g), representing the solution on a number line. Which legal case forced the university of maryland to admit an african american student to its law school?henderson v. United statesguinn v. United statesmurray v. Pearsonplessy v. Ferguson. Using the given DNA segment, design 18-22 bases primers to amplify this whole DNA fragment. Be sure you give the primers sequence in 5'>3. DNA segment: 5' GGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCCTGACAAGATCCCCTTTGTCCC CATCTCTGGTTT 3' A The soil for house plants consists of water. if someone wants to plant flowers that need water in the soil, how many liters of water they need to add to of soil? Which of the values in the set {3,4,5,6} is a solution to the equation 4x + 2 = 22?A) 3B)4C)5D)6 Rahul is scheduled to receive annual payments of $3,600 for each of the next 12 years. The discount rate is 8 percent. What is the difference in the present value if these payments are paid at the beginning of each year rather than at the end of each year Identify the correct way to cite the BLS Highest-Paying Occupations web page.O Occupational Outlook Handbook. "Highest-Paying Occupations." Bureau of Labor Statistics and US Departmentof Labor, 2015.O "Occupational Outlook Handbook." Highest-Paying Occupations. Bureau of Labor Statistics and US Departmentof Labor, 29 March 2015. Web. 1 May 2015.O "Highest-Paying Occupations." Occupational Outlook Handbook. Bureau of Labor Statistics and US Departmentof Labor, 29 March 2015. Web. 1 May 2015.O Highest-Paying Occupations, Occupational Outlook Handbook. Bureau of Labor Statistics and US Department ofLabor, 2015. Web. 1 May 2015. Federal CourtsState CourtsPower from U.S. ConstitutionPower from state constitutionHears cases involving federal lawsHears cases involving state laws.According to the above chart, which case and court are paired correctly?O Bank robbery- State CourtO Counterfeiting-Federal CourtO Piracy-State CourtO Traffic citation-Federal Court 2 quantities, a and b, have a proportional relationship, where a is -3 and b is -4. Create an equation to represent this relationship As a person breathes, during the inhale part of the cycle air moves down the windpipe (bronchus) and through a constriction where the air speed doubles. If the air is traveling 46 cm/s before the constriction and we treat air as an incompressible fluid, determine the pressure drop in the constriction. Use the density of air as 1.29 kg/m3. in Pa Millions of lightning flashes strike the ground annually in the united states causing nearly 100 deaths and 400 injuries. After a practice or game has been suspended due to inclement weather, how long do you wait to return to activities after the flash of lightning?.