Answer:
Explanation:
Invasive species are among the leading threats to native wildlife. Approximately 42 percent of threatened or endangered species are at risk due to invasive species.
Human health and economies are also at risk from invasive species. The impacts of invasive species on our natural ecosystems and economy cost billions of dollars each year. Many of our commercial, agricultural, and recreational activities depend on healthy native ecosystems.
What Makes a Species "Invasive"?
An invasive species can be any kind of living organism—an amphibian (like the cane toad), plant, insect, fish, fungus, bacteria, or even an organism’s seeds or eggs—that is not native to an ecosystem and causes harm. They can harm the environment, the economy, or even human health. Species that grow and reproduce quickly, and spread aggressively, with potential to cause harm, are given the label “invasive.”
An invasive species does not have to come from another country. For example, lake trout are native to the Great Lakes, but are considered to be an invasive species in Yellowstone Lake in Wyoming because they compete with native cutthroat trout for habitat.
as you read through the research in case study: sea turtles, keep in mind the three basic steps of addressing challenges to ecological well-being. answer these three questions as you review the information on the everglades
Three question that are missing from given question are as follows:
Identify the problem(s) at hand.
Determine the cause of the problem(s).
Recommend solutions to the problem(s).
Answer:
The nesting area of ocean turtles could be saved and secured with the assistance of commitment of neighborhood individuals , maintaining a strategic distance from of beach fires during nesting season. Leave the enough beach area for the turtles to hatch their egg and nesting.
There ought to be negligible lighting close to the settling regions as arched turtles are attracted to light and they may wind up moving towards the city as opposed to the water. Local people could protect the hatching eggs from other wild creatures and winged animals by tagging them and keeping a nearby eye.
Beach region should be cleanup as the debri are the significant reason forever danger to the turtles and all other marine creatures.
Heavy growth in the incubator after bacterial strains were incubated in candle and anaerobic jars
Answer:
Heavy growth in the incubator refers to the significant increase in the number of bacteria that were being cultured or grown in a controlled environment. The incubator refers to the device that provides the optimal conditions, such as temperature and humidity, for the growth of microorganisms.
Explanation:
When bacterial strains were incubated in candle and anaerobic jars, it means that the bacteria were placed in two different environments to observe their growth. The candle jar is used to create a low-oxygen environment, while the anaerobic jar creates a completely oxygen-free environment. The fact that there was heavy growth observed indicates that the bacteria thrived and multiplied rapidly in both the candle jar and anaerobic jar. This means that the bacterial strains were able to adapt and survive in low-oxygen or oxygen-free conditions. Overall, the observation of heavy growth in the incubator after incubating the bacterial strains in candle and anaerobic jars highlights the ability of these bacteria to flourish in specific environments with limited or no oxygen availability.
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
what best describes the process of science?
Answer:
The process of science refers to the practices employed in science to uncover knowledge and interpret the meaning of those discoveries.
Oxygen is produced.
Select one:
O a. Both Photosynthesis and Cellular Respiration
b. Photosynthesis
c. Cellular Respiration
d. Neither Photosynthesis nor Cellular Respiration
Answer:
b.Photosynthesis
Explanation:
as plants produce 02 in the presence of light
Answer:
Option(B):Photosynthesis
Explanation:
Cellular respiration, the process by which organisms combine oxygen with molecules,
in photosynthesis oxygen is produced
In humans, an X-linked disorder called coloboma iridia (a split in the iris of the eye) is a recessive trait. A normal couple has a daughter with coloboma iridia. The husband sues the wife for divorce on the grounds of infidelity (cheating). Would you rule in his favor
Why are Euglena and Trypanasoma placed in different classes?
Explanation:
Euglena and Trypanosoma are placed in different classes because they belong to different taxonomic groups based on their distinct characteristics, evolutionary relationships, and overall organization. The classification of organisms is determined by their shared similarities and differences, allowing scientists to group them into various hierarchical categories.
Euglena and Trypanosoma belong to different classes due to the following reasons:
1. Morphological Differences: Euglena is a unicellular, freshwater protist that possesses a characteristic whip-like tail called a flagellum, allowing it to move and propel itself. It also contains a photosynthetic pigment called chlorophyll, enabling it to perform photosynthesis. On the other hand, Trypanosoma is a parasitic protist that causes diseases such as African sleeping sickness and Chagas disease. It possesses a single flagellum but lacks chlorophyll and cannot perform photosynthesis.
2. Evolutionary Relationships: Classification takes into account the evolutionary relationships between organisms. Euglena belongs to the class Euglenophyceae, which includes various species of photosynthetic protists. They are considered to be a diverse group that originated from a common ancestor. Trypanosoma, however, belongs to the class Kinetoplastea, which includes various parasitic flagellates. These organisms are not closely related to Euglena, indicating a distinct evolutionary history.
3. Biochemical and Genetic Differences: Euglena and Trypanosoma also differ biochemically and genetically. They have distinct cellular structures, metabolic pathways, and genetic compositions that contribute to their unique characteristics and lifestyles. These differences further support their classification into separate classes.
By considering these factors, taxonomists and scientists classify organisms into appropriate hierarchical categories, ensuring that organisms with shared characteristics are grouped together while differentiating them from organisms with distinct features. The placement of Euglena and Trypanosoma in different classes reflects their distinct biological attributes and evolutionary histories.
Answer:
Explanation:
Euglena and Trypanosoma are both unicellular organisms that belong to the kingdom Protista, but they are placed in different classes because they have different characteristics and lifestyles. Euglena is a photosynthetic organism that can produce its own food using sunlight, and it has a structure called a chloroplast that contains pigments such as chlorophyll. It also has a flagellum, which it uses to move around in its aquatic environment. Euglena belongs to the class Euglenophyceae, which includes other photosynthetic unicellular organisms that have similar characteristics. On the other hand, Trypanosoma is a parasitic organism that feeds on the blood of its host, and it does not have the capability to photosynthesize. It moves by using a single flagellum and has a unique structure called a kinetoplast, which contains DNA and other important cellular components. Trypanosoma belongs to the class Kinetoplastea, which includes other parasitic unicellular organisms that have similar characteristics. Therefore, Euglena and Trypanosoma are placed in different classes based on their different modes of nutrition, locomotion, and other morphological and physiological characteristics.
patch Adams movie
1. What is the film all about? Summarize in 5-10 sentences.
2. What moments, characters, or ideas resonated with you while watching this movie? What about them? Why did you connect with them?
3. What was/were the scientific breakthrough(s) in the movie that led to today's scientific advancement?
4. What were the scientific challenge(s) encountered by the main character(s) of the story and how did the character(s) overcome it/them?
5. What thoughts does this movie spur in you? What does it make you think about? 6. What were the issues shown in the film related to modern society?
A movie, also known as a film, is a form of visual storytelling that typically involves a series of moving images presented on a screen, along with accompanying sound and sometimes other sensory experiences such as smell or touch.
Movies are a popular form of entertainment and can cover a wide range of genres, including drama, comedy, action, horror, science fiction, and many others.
Learn more about Patch Adams here https://brainly.com/question/30157448
#SPJ1
In the Patch Adams movie, Patch faces opposition from the medical establishment and personal setbacks, but ultimately finds success and inspires others to follow his lead in medicine.
What is the Patch Adams movie about?"Patch Adams" is a film based on the true story of a medical student named Hunter "Patch" Adams, who believes that humor and compassion are essential components of patient care.
After experiencing his own struggles with depression and sui_cidal thoughts, Patch checks himself into a mental institution, where he realizes that he wants to use his own experiences to help others.
He decides to attend medical school and revolutionize the healthcare system by introducing a new approach to medicine that prioritizes human connection and happiness.
One of the most powerful moments in the movie for me was when Patch visits the terminally ill patient, Rudy, and together they create a joyful and vibrant funeral for Rudy before he passes away. I connected with this scene because it showed how humor and compassion can be used to bring joy and meaning to difficult situations.
While the film does not necessarily focus on specific scientific breakthroughs, it does highlight the importance of empathy and human connection in healthcare, which is an area that is increasingly being studied and valued in modern medicine.
One of the main scientific challenges that Patch encounters in the movie is the resistance of the medical establishment to his unconventional methods.
The film made me think about the ways in which the healthcare system can be dehumanizing and isolating, and how important it is to prioritize empathy and connection in patient care.
The film touches on a number of issues related to modern society, including the over-medicalization of healthcare, the need for more human connection and empathy in patient care, and the importance of mental health and self-care.
Learn more about Patch Adams movie at: https://brainly.com/question/6759285
#SPJ1
12. Portal system is not associated with which of the following organs/tissues?
B. Liver
A. Nephrons
C. Pituitary
D. Alveoli
Alveoli is not associated with portal system .
Hence , OPTION D is correct .
A) Liver : it comes under hepatic portal system .
B) Nephrons : it comes under renal portal system .
C) pituitary : it comes under Hypophyseal portal system .
Portal system :it can be defined as major venous system which carries capillary blood from esophagus , stomach ,small and large intestine , pancreas , gallbladder and spleen to liver .
there are three types of portal system ; hepatic portal system , renal portal system , and hypophyseal portal system .
Hypophyseal portal system :It is a system of blood vessels in the microcirculation which connects the hypothalamus with the anterior pituitary . it helps in the quick transport and exchange of hormones between hypothalamus and anterior pituitary.
Hence , OPTION D is correct .
Learn more about hepatic portal system here :
brainly.com/question/10351128
#SPJ9
A student conduct an experiment to test how the temperature of affects the amount of sugar that can dissolve in water. In the experiment, she’s 100 mL of water in each trial in stairs for five minutes each time. What is the independent variable? The amount of water the Times third the amount of sugar the temperature of the water
Answer:
B) the temperature of the water
Explanation:
Explanation: The independent variable is the one that is manipulated or changed
Which of the following are a part of the circulatory system? I. Blood II. Lungs III. Heart IV. Blood Vessels A. I, II, III, and IV B. II, III, and IV C. I, III, and IV D. I and IV
Option A is correct as I, II, III, and IV are all a part of the circulatory
system.
The circulatory system, also known as the cardiovascular system, is a complex network of organs and vessels responsible for transporting blood, oxygen, nutrients, hormones, and other necessary substances to different parts of the body. It also plays an important role in the removal of metabolic waste and carbon dioxide from the body.
I. Blood is a vital component of the circulatory system that flows through the blood vessels and carries oxygen, nutrients, hormones, and other substances to different parts of the body.
II. Lungs are also a part of the circulatory system as they help to oxygenate the blood by allowing oxygen from the air to enter the bloodstream and carbon dioxide to be eliminated from it.
III. Heart is a muscular organ that pumps blood to the entire body. It is the center of the circulatory system and also responsible for regulating blood pressure.
IV. Blood Vessels include arteries, veins, and capillaries. Arteries carry oxygen-rich blood from the heart to the body and veins return oxygen-poor blood to the heart. Capillaries are small, thin-walled vessels where the exchange of oxygen, nutrients, and other substances takes place between the blood and the tissues.(option-a)
For such more questions on circulatory
https://brainly.com/question/946975
#SPJ8
what physical property is a golf ball having more mass than a tennis ball
Answer:
the density of the golf ball is greater than a tennis ball. If the density is greater, more mass is pack into the golfball of the same size while a tennis ball has lower mass.Explanation:
what do you call the very fine particles that you formed after pounding the pieces of rocks with a hammer
Answer:
fine particles (silt and clay) are moved to areas of still water (off-shore settings). the majority of these particles are made up of clay minerals, which are weathering products of feldspars and ferro-magnesian minerals.
Answer:
You call them minerals
Explanation:
Ancestors of giraffes with shorter necks could not reach branches high up in trees for food. This led to ____ for longer necked giraffes. A. stabilizing selection B. disruptive selection C. artificial selection D. directional selection.
Answer:
Ancestors of giraffes with shorter necks could not reach branches high up in trees for food. This led to directional selection for longer-necked giraffes.
Explanation:
The theory of Evolution by Charles Darwin and Alfred Russel states that
Diverse groups of animals evolve from one or a few common ancestors.Which of the steps below is NOT important for wellness?
A. focusing on quality of life
B.keeling all aspects of life at all times
C. creating balance
D.keeping all aspects of ife the same at all times
taking personal responsibility
PLSSSSS HURRY
Answer:
Possibly B? I'm not sure. Sorry if incorrect.
GIVING BRAINLIEST TO FASTEST CORRECT ANSWER (TIMED)
Two communities have a contamination area of 576 square meters and are given methods A, B, and C to clean up
the contamination area. Community 1 is a smaller community and therefore has less resources such as monies
available for the clean-up. Community 2 has more resources but more endangered species of plants and animals in
the contamination area. The longer the contamination is present the more harm there is to the environment including
living things. There are a variety of methods for cleaning up contamination in bodies of water and soil. Look at the
data table below and pick the best method for each community.
1. Using table 1, state which method would be best for community 1 and 2 at 10°C. Justify your answer.
Community 1:
Community 2:
2. Using table 1, state which method would be best for community 1 and 2 at 20°C. Justify your answer.
Community 1:
Community 2:
3. Using table 2, state which method and at what concentration would be best for community 1 and 2. Justify
your answer.
Community 1:
Community 2:
A. Considering table 1, the following procedure would work the best for communities 1 and 2 at 10°C:
Community 1: Method A because it is significantly less expensive than Method B and removes pollution more quickly than Method C.
Community 2: Method B because it preserves the lives of the local endangered species and removes contaminants more quickly than the other ways.
B. The approach that would work best for communities 1 and 2 at 20°C using table 1 is:
Community 1: Method C since it is less expensive and removes pollution more quickly.
Community 2: Process A since it removes pollution the fastest of the available options.
C. For communities 1 and 2, the technique and concentration that would work best are:
Community 1: Using Method A at 100 ppm is less expensive and less harmful to the environment.
Community 2: Compared to the other techniques, Method B at 200 ppm cleans up the contamination the fastest and with the least amount of environmental harm.
What are the main contaminants in the environment?Polyaromatic hydrocarbons, heavy metals, pesticides, organic solvents, inorganic solvents, and other pollutants are among the most prevalent environmental contaminants. Accidental discharge of these toxins into the environment causes the emergence of new diseases that affect human health as well as population deaths in large numbers.
Radon and biological agents such as molds, certain infectious agents such as bacteria or viruses, and dust mites also contaminate the environment.
Learn more about environmental contamination at: brainly.com/question/19621497
#SPJ1
Question multiple Choice with a pairs)
01.05 MC
Which situation shows where potential energy and komencemegy are balans
A stopped bicycle
A roller coaster car going uphill
A car moving at a steady speed
Arunner slowing down
A town in the Finger Lakes region wants to promote solutions to reduce acidification. In order to help the town in their efforts, what solution should they promote? Explain why
decreased motor boat traffic on the lake
increased introduction of zebra mussels
decreased use of CFCs
protect the fish species living in the lake
Answer:
Explanation: The town in the Finger Lakes region should promote the solution of decreased motor boat traffic on the lake. Acidification is mainly caused by the high levels of carbon dioxide that enter the water from the atmosphere, and motor boat traffic can worsen this by increasing the amount of carbon dioxide in the air. Reducing motor boat traffic on the lake would help to decrease the amount of carbon dioxide entering the water, and thus reduce acidification. The other solutions listed (increased introduction of zebra mussels, decreased use of CFCs, and protecting fish species) may have other environmental benefits, but they are not directly related to reducing acidification.
Which of the following forests contains 50% of terrestrial plants and animal species?
Answer:
This question lacks options, they are:
a)Cold forest
b)Tropical forest
c)Temperate forest
d)Cloud forest
e)Alpine forest
The answer is B. Tropical forest
Explanation:
Tropical forest is one of the forests found in nature. The tropical forest receives the best environmental conditions in terms of vegetation growth. Hence, it is said to contain the most diverse organisms in nature. This means that tropical forests holds more species of terrestrial organisms than any other forest or biome.
Therefore, tropical forests are believed to contain 50% of the Earth's terrestrial plants and animal species due to their biodiversity richness.
If the board is 2 meters in length, and the girl on the left who is 45 kg is far away 0.8 meters from pivot point what is the mass of the girl on the right
Answer: 100
Explanation:
Help me solve it my life depends on it
The correct matches are:
C. ChromosomeF. NucleusE. Eukaryotic cellA. DNAWhat are chromoomes?C. Chromosome: Chromosomes are structures within cells that contain DNA, genes, and other genetic material.
F. Nucleus: The nucleus is a membrane-bound organelle found in eukaryotic cells that contains the cell's DNA and is responsible for controlling cell functions and gene expression.
E. Eukaryotic cell: Eukaryotic cells are cells that have a true nucleus enclosed within a membrane and other membrane-bound organelles. They include cells of plants, animals, fungi, and protists.
A. DNA: DNA (deoxyribonucleic acid) is a molecule that carries the genetic instructions used in the development and functioning of all living organisms. It contains the genetic information necessary for the growth, development, and reproduction of cells and organisms.
Learn more about DNA and chromosomes at: https://brainly.com/question/29786859
#SPJ1
How would you explain the key concepts for the CWA in less than two minutes?
Answer:
Explanation:
vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.
Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.
Navigable Waters of the United States For the purposes of the Clean Water Act, the term "navigable waters" includes:
all waters used in commerce, including groundwater;
all interstate waters including wetlands, mudflats, and sand-flats; and
all other waters such as lakes, rivers, streams, wetlands and sloughs.
EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters." The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect. In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.
Additional executive orders were issued 2015 in 2019. Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.
Could the requirement for one or more NPDES Discharge Permit apply to my campus?
If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.
Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.
Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.
What do I have to do related to NPDES Discharge Permits?
Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.
French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.
Details of NPDES
explain the characteristics scientists use when observing organisms and placing them in six kingdoms
. Which biomolecules do not function in supporting a cell?
Answer:
Generally the primary organic molecules in cells which support the metabolic and biochemical process of the cells are bio molecules Theses are Carbohydrate
Protein
Lipids
and Nucleic acids of DNA and RNA. They can also be the minute hormones and metabolites present in the cells.
Generally, CHO provide structural supports to the cells,and acts as sources of energy.
Protein forms most enzymes for biochemical reactions,and aids movements, through muscle contractions. Besides,muscles are made of protein.Therefore protein forms the structural basis of the muscles.This aids movement and locomotion for support.
Lipids are the richest source of energy for the cell,and provides support the cells membrane.
The nucleic acids,are primary concerned with the transfer of inheritable characteristic from mother cells to the daughters during reproduction.While the DNA is the genetic information been transferred,the RNA is the vehicle for transmission of the genetic information as protein from the parents' nucleus to the offspring. Thus the nucleic acid roles it for transmission of genetic information as genes,(DNA) and translation of these genes as proteins(RNA).Hence,Nucleic acids does not participate in the cells' support.
Therefore
Explanation:
Answer:
Nuclei acids do not function in supporting a cell
answer pls quickly i need help
Answer:A decrease in oxygen in the air
Explain: Trees produce photosynthesis and photosynthesis makes oxygen and if the tree is gone then there will be a temp decrease in oxygen
Abdominal aorta is located in
Answer:
An abdominal aortic aneurysm is an enlarged area in the lower part of the major vessel that supplies blood to the body (aorta). The aorta runs from your heart through the center of your chest and abdomen.
Explanation:
In an oil spill, why does the oil not mix with the seawater?
Lipids are hydrophobic.
Lipids are hydrophilic.
Lipids are saturated.
Lipids are unsaturated.
Answer:
liquids are hydrophobic
A
Answer:
a
Explanation:
Choose the statements that correctly describe the structure and function of proteasomes.
a. The proteasome hydrolyzes the unfolded proteins to free amino acids, which are then recycled.
b. The 26S proteasome unit is composed of a 12S component and a 14S component.
c. One of the 19S regulatory particles cleaves ubiquitin from the protein.
d. Proteasomes would not be expected to use ATP to degrade small, unfolded peptides.
e. The proteolytic sites of the proteasome are located at the middle of the 20S core.
f. Proteasomes degrade proteins to small peptides.
Answer:
the protesome hydrollyzes the unfolded proteins to free amino acids which are then recycled.
Proteasome is one of the 19S regulatory particles cleaves ubiquitin from the protein.
Function of proteasomesThe proteasome is a multisubunit enzyme complex that plays a central role in the regulation of proteins that control cell-cycle progression and apoptosis.
Thus, we can conclude that the statements that correctly describe the structure and function of proteasomes is;
Proteasome is one of the 19S regulatory particles cleaves ubiquitin from the protein.
Learn more about Proteasome here: https://brainly.com/question/9327071
#SPJ2
Which of the following is the correct sequence of events during mitosis?
Condensation → Nuclear membrane disassembly → Arrangement at equator → Centromere division → Segregation → Telophase is the correct sequence of events during mitosis.
During prophase, the chromosomes condense, the nucleolus disappears, and the nuclear envelope breaks down. The chromosomes align at the metaphase plate, the centromeres divide and during telophase, the chromosomes segregate and move to opposite ends of the cell and two nuclei are formed.Prophase is the first phase of mitosis. The chromosomes in the nucleus start to condense and become visible at this point.Prometaphase is the following phase. The nuclear envelope disintegrates at this time, and the chromosomes cling to the spindle fibres.Metaphase is the third phase. The chromosomes align on the metaphase plate in the centre of the cell during this time.Anaphase is the fourth phase of mitosis. The spindle fibres force the chromosomes apart at this stage, causing them to migrate to the opposing ends of the cell.Telophase is the final phase. Chromosomes have now reached the cell's poles, and the cell is beginning to divide into two daughter cells.To know more about mitosis check the below link:
https://brainly.com/question/19058180
#SPJ4
Which statement describes the Mercalli scale?
1 This scale measures seismic waves based on their size.
2 This scale rates an earthquake according to how much damage it causes.
3 This scale produces a single rating for earthquakes that reach the surface.
4 This scale measures the magnitude of an earthquake based on the size of seismic waves.
Answer:
2- this scale rates an earthquake according to how much damage it causes
Mercalli scale rates an earthquake according to how much damage it causes. So, the correct option is B.
What is Mercalli scale?The Mercalli scale was invented by Giuseppe Mercalli in 1902, is not regarded as a scientific method for measuring the strength of an earthquake.
The Mercalli scale is used in the observations of people who experienced an earthquake to estimate the intensity, which is measured based on the degree of impact or damage to humans, objects, buildings, and other man-made things.
The scale typically measures the intensity of an earthquake using data such as effects on the Earth, the environment and humans that help predict whether an earthquake was fatal.
Thus, Mercalli scale rates an earthquake according to how much damage it causes. So, the correct option is B.
Learn more about Mercalli scale, here:
https://brainly.com/question/16948307
#SPJ6