Answer:
Thyroid
Explanation:
Need help ASAP! Pleasee
Answer:
The answer of the question is
Option D
Both B And C
PLEASE MARK ME THE BRAINLIEST
I hope it helped you
You're discussing a forensic crime scene show with your roommate, who insists that fingerprints are left behinsd due to the sebum on our fingertips. What do you tell him?
Answer:
True
Explanation:
Sweat is not the only source of lipids found in fingerprints, however. Sebaceous glands on your face and scalp secrete an oily sub- stance known as SEBUM, which keeps your skin waterproof. ... Many factors can contribute to the quality of a fingerprint left behind.
4. Polydactyl (extra fingers and toes) is due to a dominant gene. A man who is polydactyl, marries a woman with a
normal phenotype. They have a normal child.
a. What is the genotype of the father?
b. What is the genotypes of the mother?
c. Draw a Punnett square and give the genotype & phenotype of the offspring.
In 1980, Mount St. Helens erupted in Washington State. Hot air and debris destroyed the surrounding forest. Since
then, scientists have been studying this area and are observing the ecological succession that is occurring.
Which graph shows what scientists have most likely observed about the species diversity in the area since 1980?
Species Diversity
Species Diversity
Time (years)
Time (years)
ecies Diversity
ecies Diversity
Answer:
Helens' vicitims died by asphyxiation from inhaling hot volcanic ash, and some by thermal and other injuries. The lateral blast, debris avalanche, mudflows, and flooding caused extensive damage to land and civil works. All buildings and related manmade structures in the vicinity of Spirit Lake were buried. So it would be the graph that goes down.
Explanation:
The graph that depicts the that scientists have mostly observed diversity of species in that area is graph A.
What was the impact of Mount St. Helen's eruption?The 1980 Mount St Helens eruption in Washington state leads to the release of hot air with debris that destroyed the forests ad surrounding lands.
The victims died from inhaling the gas and others got injured. The lateral blasts and debris avalanche, along with mudflow created extensive damage to land and property.
Find out more information about Mount St. Helens.
brainly.com/question/17162207
Both the respiratory system and the digestive system involve the uptake of
necessary molecules from an animal's surroundings. Alveoli are tiny sacs that aid in
the exchange of carbon dioxide and oxygen in the lungs. Intestinal villi are tiny
projections along the lining of the intestines used to take in nutrients from food
passing through.
Alveoli
Intestinal Villi
M
GAIN
O
CLEAR ALL
Endocrine
Integumentary
Immune
Circulatory
Digestion procedures are carried out by the digestive system. The gastrointestinal tract and its supporting organs make up the digestive system. This continuous tract extends from the mouth to the anus. Sphincters, which are muscles, operate as barriers between various sections of this tract.
The pharynx, oesophagus, stomach, small intestine, large intestine, rectum, and anus are all parts of the gastrointestinal system. Salivary glands, the liver, pancreas, and gallbladder are connected organs.
With the aid of some substances, such as enzymes and gastrointestinal motility, nutrition is broken down into little particles until the intestine can absorb them.
to know more about enzymes , visit to:-
https://brainly.com/question/14953274
#SPJ1
You are researching an enzymatic protein in the lab and make the following observations. The usual form of the protein is globular (spherical) however, when a sample of the protein is treated with a chemical that reduces disulfide bonds, the rate of enzymatically driven product formation decreases dramatically and multiple globular proteins can be detected in the sample. From these observations you conclude: A. The primary structure of the protein contains multiple cysteine residues that are hydrolyzed by the chemical reductant. B. The protein is most likely composed of multiple polypeptide chains that are held together by disulfide bonds C. The protein is most likely composed of a helices that are held together by disulfide bonds. D. The primary and secondary structure of the protein depends on disulfide bonds. E. None of the provided statements are reasonable conclusions based on the observations,
Answer:The protein is most likely composed of multiple polypeptide chains that are held together by disulfide bonds
Explanation:
The Disulfide bonds in protein membranes are usually seen in bacteria and eukaryotes.
Answer:
Option B
Explanation:
Since the usual shape of the protein is supposed to be globular and even after treatment, it still produces the same globular proteins despite the reduction of its disulphide bonds.
The disulphide bonds should have disrupted the shape formation if it had been a mechanism for its shape formation but since multiple globular polypeptide resulted from the treatment it can be assumed that the multiple polypeptide chains are held together by disulfide bonds which are hydrolyzed by the chemical.
What is a stomata?
A. the little mouths on the leaf of a plant where they take in CO2,and release 02
B. Where the plant takes in water
A. the little mouths on the leaf of a plant where they take in CO2,and release 02
stoma=mouth
Those structures are located on the backside of the leaf
Circle the best answer
A biome is characterized by certain flora and fauna. Option C.
What is a biome?
A biome is a large expanse of land or biogeographical unit characterized by certain species of plants and animals and delimited by climatic factors such as precipitation, pressure, amount of sunlight, the type of soil, etc.
A biome is not delimited by geographical boundaries. In other words, a single biome may span across countries or even continents. There are 5 major biomes in the world. These include
aquatic biomesgrassland biomesforest biomesdesert biomestundra biomesThus, in a particular geographical area, a mixture of biomes may be present. For example, a country may have aquatic biomes, grassland biomes, and forest biomes. Each biome is primarily characterized by the type of plant and animals that they contain.
More on biomes can be found here: https://brainly.com/question/11491362
#SPJ1
25. (03.06 LC)
In which zone would you expect to find the least amount of biodiversity due to the variable conditions it experiences? (3 points)
Sublittoral zone
Low intertidal zone
High littoral zone
O Middle intertidal zone
In the High Littoral Zone one can expect to find the least amount of biodiversity.
What are Littoral Zone?
When sunlight is present at the sediment level, aquatic plants that are partially to totally submerged flourish and are said to be in the littoral zone of an aquatic ecosystem(river, lake, or sea). Numerous nutrients, dissolved oxygen, water velocity, and alternate periods of submersion and exposure are other characteristics.
What is Biodiversity?
The variety of animals, plants, fungi, and even microorganisms like bacteria that make up our natural environment are all included in what is known as biodiversity. These various species and organism collaborate in complicated web-like ecosystems to keep things in balance and support life.Biodiversity supports everything in nature that we need to survive: food, clean water, medicine, and shelter.
Therefore, High Littoral Zone would be the correct answer.
To know more about Littoral Zones, refer the given link:
https://brainly.com/question/7412092
#SPJ1
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
Nitrogen, oxygen, carbon dioxide and other gases are all directly a
part of which Earth system?
the biosphere
don't use it immediately cause i dont have much to back it up just from my memory.
Answer:
biosphere
Explanation:
Need this answered right away
Which of the following equations represents the right chemical process that occurs in photosynthesis? Question 14 options: A) Six molecules of oxygen plus six molecules of water plus light energy converts six molecules of carbon dioxide plus sugar. B) Six molecules of water plus six molecules of hydrogen plus six molecules of oxygen converts light energy plus sugar. C) Six molecules of carbon dioxide plus sugar plus light energy converts six molecules of carbon and six molecules of oxygen. D) Six molecules of carbon dioxide plus six molecules of water plus light energy converts six molecules of oxygen plus sugar.
Answer: D) Six molecules of carbon dioxide plus six molecules of water plus light energy converts six molecules of oxygen plus sugar.
Explanation:
- the equation for photosynthesis is:
6CO2 + 6H2O + light energy → C6H12O6 + 6O2
- C6H12O6 is glucose which is the sugar
hope this helps :)
ses/17549/discussion_topics/235908
G
NCCT
L
Log In to Canvas Cengage eTextbook
Receptionist and the Medical Office Environment Ethics:
Chapter 5 discusses the emerging role of the medical receptionist, which includes knowing and understanding a wide
variety of laws and regulations, answering an almost constantly-ringing telephone, reviewing insurance cards, determining
insurance types or managed care plans, entering demographic data into the computer, posting a variety of transactions,
scheduling appointments, and professionalism. In other words, working as a receptionist in a medical office should be a
professionally trained medical assistant who is flexible and prepared for a variety of duties.
Scenario:
You are the patient and enter a medical office. You notice a faint smell of urine and approach the reception desk where the
receptionist is talking on the telephone. She never looks up and you wait at the desk for a few minutes, but finally give up
and sit down. She keeps talking while chewing gum and you notice her blouse is low-cut.
Instructions: For your initial post, answer the following 2 questions:
a. Discuss three (3) possible ways you could respond to her without seeming rude or embarrassing her (in your own
words).
b. How should this behavior be addressed? Who should address this employee?
Cl
a. Discuss three (3) possible ways you could respond to her without seeming rude or embarrassing her (in your own words):
Approach the situation with empathy: Begin by acknowledging the receptionist's presence and politely express your need for assistance. You can say something like, "Excuse me, I'm sorry to interrupt. I have an appointment and was wondering if you could help me with the check-in process?"Express concern and ask for clarification: In a non-confrontational manner, mention the faint smell of urine and inquire if there is a maintenance issue or if they are aware of the situation. You can say, "I noticed a faint smell and wanted to make sure everything is alright. Is there perhaps a maintenance issue that needs attention?"Provide feedback in a constructive manner: Share your observations about the receptionist's behavior without accusing or being judgmental. Use "I" statements to express how their actions made you feel. For example, you could say, "I noticed you were on the phone and it took me a while to get assistance.b. How should this behavior be addressed? Who should address this employee?
The behavior of the receptionist should be addressed to ensure a professional and welcoming medical office environment. Ideally, the responsibility lies with the supervisor or manager of the medical office.
The supervisor or manager should approach the situation with professionalism and sensitivity, providing clear feedback on the observed behavior and its impact on patients.
The discussion should also provide an opportunity for the receptionist to share any challenges they may be facing or reasons for their behavior, allowing for open communication and the possibility of addressing any underlying issues.
for similar questions on medical receptionist.
https://brainly.com/question/10586507
#SPJ8
What causes the "heat island" effect?
a. heat produced from a large number of people
b. the materials used in building cities retain heat
C. the large amount of reflected light from glass windows
d. all of the above
Please select the best answer from the choices provided
A
B
C
D
Answer:
B. The materials used in building cities retain heat
Explanation:
The metropolitan region where the heat island effect is most pronounced is much warmer than the surrounding, natural, rural lands. The materials used in building, along with energy emissions from industry and transportation (cars), are to blame for the effect. For instance, because asphalt is impermeable, heat is reflected back into the air rather of being transferred to the ground like it does by flora and trees. Typically, heat islands are 2 to 6 degrees F warmer. Urban areas stay warm in the nights while the nearby rural regions drop down; the difference can be as high as 20 degrees F.
Communities may experience a rise in heat-related sickness and death, air pollution, air conditioning expenses, and water quality during the summer months due to heat islands.
What are 3 activities that release carbon dioxide into the atmosphere?
Answer:
Burning fossil fuels, releasing chemicals into the atmosphere, reducing the amount of forest cover, and the rapid expansion of farming, development, and industrial activities are releasing carbon dioxide into the atmosphere and changing the balance of the climate system.
What are the top 3 human activities that produce CO2?
Eighty-five percent of all human-produced carbon dioxide emissions come from the burning of fossil fuels like coal, natural gas and oil, including gasoline. The remainder results from the clearing of forests and other land use, as well as some industrial processes such as cement manufacturing.
What causes carbon dioxide to increase in the atmosphere?
Human Activity Is the Cause of Increased Greenhouse Gas Concentrations. Over the last century, burning of fossil fuels like coal and oil has increased the concentration of atmospheric carbon dioxide (CO2). This increase happens because the coal or oil burning process combines carbon with oxygen in the air to make CO2.
Hope this helps :)
Pls brainliest...
A scientist is studying fossils in layers of rock and observes that whole groups of fossils disappear from the fossil record above a
certain age.
Which conclusion is most likely true based on this observation?
O A mass extinction occurred that wiped out many ancient species.
O The species all migrated to different parts of the world.
O Older species developed new forms to become new species
O Death rates for these species declined due to favorable environments.
by
Several extinct species were wiped off by a mass extinction that took place.
What happens to fossils' ages as we go further into the Earth's layers?The topmost layers, those nearest to the Earth's surface, are the most recent to form. Lower layers are older. Considering that sedimentary rocks are layered.
Why are there fossils in the upper layers' lower ones?Particle by particle and bed by bed, layers of sedimentary rocks are built up one on top of the other. As a result, on each bed in a series of layered of rocks must be older than the beds above it.
To know more about species visit:-
https://brainly.com/question/13259455
#SPJ1
temperature usually increase when water condenses. which behavior of water is most directly responsible for this phenomenon?
Answer:
the release of heat by the formation of hydrogen bonds.
Explanation:
Temperature can be defined as a measure of the degree of coldness or hotness of a physical object. It is measured with a thermometer and its units are Celsius (°C), Kelvin (K) and Fahrenheit (°F).
Condensation can be defined as a process which typically involves the change in the physical state of matter from the gaseous phase into a liquid phase i.e water changing from gas (vapor in the air) into a liquid form.
Temperature usually increase when water condenses. This phenomenon is as a result of the release of heat (exothermic reaction) by the formation of hydrogen bonds in water i.e hydrogen-hydrogen bond in water molecules formed by the chemical elements; oxygen and hydrogen.
in physiological Genotype and phenotype disorder male and female in reproductive system
Both males and females can experience reproductive system disorders. These disorders can be caused by genetic factors, hormonal imbalances, structural issues, infections, or other medical conditions. In males, these disorders may include erectile dysfunction, infertility, testicular disorders, prostate problems, and hormonal imbalances. In females, they may include menstrual disorders, polycystic ovary syndrome, endometriosis, uterine fibroids, ovarian cysts, infertility, and hormonal imbalances. Treatment options vary depending on the specific disorder and may involve medication, hormonal therapy, surgery, or assisted reproductive technologies.
Misfirw code is a type of ? DTC
Answer:P0300 code denotes “Random or Multiple Cylinder Misfire Detected.” This diagnostic trouble code (DTC) implies that your car's computer detected random or multiple-cylinder engine failures. Along with P0300, you'll probably see another OBD-II code, ranging from P0301 to P0308. All these codes indicate engine misfires.
Explanation:
How do air masses get from one place to another?
infiltration
transpiration
evaporation
transportation
Air masses get from one place to another through evaporation
What locations do evaporation and transpiration occur in?
Water that evaporates into the atmosphere from the soil surface, the groundwater table's capillary edge, and land-based bodies of water is referred to as evapotranspiration. Transpiration, or the transfer of water via plants from the soil to the atmosphere, is also a component of evapotranspiration.
Water on the surface of the earth enters the soil through a process called infiltration. The rate at which soil can absorb rain or irrigation is known as infiltration rate in soil science. It is expressed in millimeters per hour or inches per hour. As the soil becomes saturated, the rate slows.
To learn more about evaporation use:
https://brainly.com/question/24258
#SPJ1
When the carbohydrate cellobiose is digested into two glucose monosaccharide sugars (by cellulase in certain fungal species), the resulting glucose monomers are properly defined as: A. the catalysts
B. the substrates
C. the enzymes
D. the reactants
E. the products
When the carbohydrate cellobiose is digested into two glucose monosaccharide sugars (by cellulase in certain fungal species), the resulting glucose monomers are properly defined as the products
The correct answer is option E.
When the carbohydrate cellobiose is digested into two glucose monosaccharide sugars by cellulase in certain fungal species, the resulting glucose monomers are properly defined as the products.
In a chemical reaction, reactants are the starting materials or substances that undergo a change, while products are the resulting substances formed after the reaction. In this case, cellobiose is the substrate, which is the molecule that undergoes the enzymatic reaction. Cellulase is the enzyme responsible for catalyzing the digestion of cellobiose into glucose monomers.
The enzyme cellulase acts as a catalyst in the reaction, facilitating the breakdown of cellobiose into glucose. Catalysts are substances that increase the rate of a chemical reaction without being consumed or permanently changed themselves. However, in the context of the given question, the glucose monomers produced are the final result or product of the enzymatic digestion process.
Therefore, in the digestion of cellobiose, the resulting glucose monomers are correctly identified as the products (option E).
For more such information on: carbohydrate
https://brainly.com/question/336775
#SPJ8
What are the best techniques for anchoring aquarium plants in substrate to ensure their healthy growth?
A few techniques that can be used to anchor aquarium plants in substrate for healthy growth includes; Tieing the plant to a rock or piece of driftwood, Using plant weights, Planting the plant in a pot and Using aquarium glue.
How would you use the above mentioned techniques to anchor aquarium plants?Tying the plant to a rock or piece of driftwood: This method works great for plants with rhizomes, like Anubias and Java Fern, as you mentioned.
Planting the plant in a pot: Some plants can do well when planted in pots with their preferred substrate. This is good because it is in a controlled enviroment and you can move plant without disturbing the plant.
plant weights: This method is said to be okay for buoyant plants that tend to float away before their roots can establish. However this can be disadvantagous if the weight is made with lead.
aquarium glue: This can be very effective for certain types of plants. It's important to use a glue that is safe for aquarium use (i.e., cyanoacrylate-based glues).
Find more exercises on aquarium plants;
https://brainly.com/question/14391481
#SPJ1
when did human activity affect a few species and cause them to trophic cascade
Human activity has caused trophic cascades in several species, with one notable example being the reintroduction of gray wolves to Yellowstone National Park in 1995.
Prior to their reintroduction, the park's ecosystem had suffered due to the absence of wolves, as their absence had allowed the elk population to grow unchecked, resulting in overgrazing of vegetation and a decline in biodiversity.
Once the wolves were reintroduced, they began to prey on the elk, which reduced the elk population and allowed vegetation to recover. As a result, the habitat of other species, such as beavers, songbirds, and even fish, improved, as they were able to utilize the newly regenerated vegetation.
This is a classic example of a trophic cascade, where the removal or addition of one species can have a cascading effect on the rest of the ecosystem.
Human activities such as hunting, deforestation, and pollution have disrupted many ecosystems, causing trophic cascades that can have far-reaching consequences for biodiversity and ecosystem functioning.
Learn more about biodiversity here:
https://brainly.com/question/13073382
#SPJ1
The complete question is:
When did human activity affect a few species and cause them to trophic cascade?
Why does sound waves travel faster in salt water than in fresh water?
Answer:
Since there are more solid's if you get what I mean..
Explanation:
Multiple-choice questions Section A Choose the most suitable answer and write the corresponding letter (A, B, C or D) in the brackets provided. 1. Which of the following is not true about air? (A) Air is a mixture, (B) The density of air is less than the densities of its gaseous components (C) Air supports burning. (D) The gases in air can be separated by physical methods. 2. Which statement about carbon dioxide gas is true? (A) It is produced when plants photosynthesise. (B) It is used in rocket fuels. (C) It relights a glowing splint. (D) It is produced when wood is burned.
Answer:
A and B is the correct answer. 888888
The atmosphere protects living things from harmful rays that come
from
water
soil
the Sun
heat
Answer:
the sun
Explanation:
it produces harmfull UV Rays
What statement best demonstrates that gene expression is regulated?
Answer:
Cells protect their DNA by enveloping it in a nucleus
Explanation:
HELP ASAP!!! :) | its only 3 questions ill give brainliest if your right
1.Which type of rock may result when sedimentary rock is exposed to extreme heat and pressure?
a. clastic
b. extrusive
c. igneous
d. metamorphic
2. In the rock cycle, how does rock become sediment?
a. Through weathering and erosion
b. through crystallization and solidification
c. through heat and pressure
d. through compaction and cementation
3. A Sedimentary rock containing a fern fossil was found. what does this tell about the area at the time the rock was formed?
a. The area was hot
b. The area was covered by and ocean
c. The area was cold
d. The area was on a land
Answer:
1:(D), 2:(D), 3:(D)
Explanation:
1) When a rock is exposed to heat and pressure, it becomes a metamorphic rock. This is correct, because this is the process that forms a metamorphic rock.
2) A rock becomes sediment through weathering and erosion. In this question, they are not asking you to explain the process of sedimentary rock formation, they are asking you how a rock becomes sediment. The process of weathering and erosion breaks down a rock, and turns that rock into smaller peices, which therefore, through the process of compaction and cementation forms a sedimentary rock.
3) A fern is a land plant. It is not found in the sea and there is not enough information given to tell whether or not the area was hot or cold. This leaves us with D. We can tell that this fossil is a land fossil because ferns do not grow in the ocean.
Hope I could help, and best of luck!
- Cat :')
Why are hypothesis so important to controlled experiments?
Answer:
Hypotheses are so important to controlled experiments because they are testable explanations for a set of observations.
----------------------------
Hope this helps!
Have a great day and God bless! :)
The scientific name for the domestic cat is Felis catis. What part of this name is the Genus name? O Felis O catus O Canis O familiaris