How can you explain humans' inability to digest cellulose?.

Answers

Answer 1

Humans' inability to digest cellulose can be attributed to the absence of the enzyme cellulase in their digestive system. Cellulase is required to break down the complex structure of cellulose into simpler forms that can be absorbed by the body.

Cellulose is a complex carbohydrate found in the cell walls of plants. While animals like cows and termites possess the necessary gut bacteria or enzymes to produce cellulase, humans lack this capability. As a result, cellulose passes through the human digestive system largely undigested, providing fiber but not contributing significant nutritional value. Nonetheless, dietary fiber has its own benefits, such as promoting bowel regularity and aiding in digestion. While humans cannot directly digest cellulose, they can rely on other food sources for essential nutrients and energy.

To know more about Cellulose

brainly.com/question/32877097

#SPJ11


Related Questions


What DNA components do all the nucleotides of the
organisms have in common?

What DNA components do all the nucleotides of theorganisms have in common?

Answers

Answer:

All nucleotides have a common structure its a phosphate group linked by a phosphoester bond to a pentose

Explanation:

Answer:

All nucleotides have a common structure: a phosphate group linked by a phosphoester bond to a pentose (a five-carbon sugar molecule) that in turn is linked to an organic base (Figure 4-1a). In RNA, the pentose is ribose; in DNA, it is deoxyribose (Figure 4-1b).

Explanation:

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:

Answers

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.

Homeostasis is the body's ability to maintain a stable internal environment despite external changes.

In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.

These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.

For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.

Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.

To know more about Homeostasis, refer here:

https://brainly.com/question/15647743#

#SPJ11

what is the difference between sex chromosomes and autosomes? how many of each is found in human cells

Answers

The difference between sex chromosomes and autosomes is sex chromosomes determine the gender of an individual, while autosomes determine other traits and characteristics. Sex chromosomes is found two ( one pair ) in human cells and autosomes is found 22 pair in human cells.

Sex chromosomes determine the gender of an individual and are responsible for the development of reproductive organs and secondary sexual characteristics. They are called sex chromosomes because they differ between males and females. Males typically have one X and one Y chromosome (XY), while females have two X chromosomes (XX). On the other hand, autosomes determine other traits and characteristics that are not related to gender, such as eye color, height, and hair texture.

In human cells, there are 46 chromosomes in total, arranged in 23 pairs. Out of these 23 pairs, two are sex chromosomes, and the other 22 pairs are autosomes. This means that human cells contain 22 pairs of autosomes and one pair of sex chromosomes, making a total of 46 chromosomes.

Learn more about chromosomes here

https://brainly.com/question/1596925

#SPJ4

HeLP me Plz I need help

HeLP me Plz I need help

Answers

Answer:The first one

Answer:

A would be the best answer

Which of the following domains include prokaryotic organisms?
A. Archaea only
B. Eukarya only
C. Archaea and Bacteria
D. Bacteria only

Answers

C. Archaea and Bacteria

Archaea and Bacteria are categorized into the domains of prokaryotic organisms, hence option C is correct.

What are prokaryotic organisms?

There are three domains of the life the Archaea, the Bacteria, and the Eukarya, in which Archaea and Bacteria belong to prokaryotic cells but eukaryotic cells belong to the Eukarya domain.

Prokaryotic organisms include the organism's absence of a nuclear membrane and not having well-defined cell organelle, this includes bacteria. It is a unicellular organism having an asexual mode of reproduction.

The Eukarya domain includes the eucaryotic cells having a true nuclear membrane, this domain includes all the eukaryote plants the human beings.

Therefore,  Archaea and Bacteria is the correct option.

Learn more about the prokaryotes, here:

https://brainly.com/question/1699177

#SPJ2

Read the passage from William Jennings Bryan's "Cross of Gold" speech.


Determine which two highlighted sentences would best support Bryan's claim that cities need farms more than farms need cities.

URGENT!!!HURRRY!!!!!!PLEASE!!!Will mark you Brainlest!!!!

"There are two ideas of government. There are those who believe that if you just legislate to make the well-to-do prosperous, that their prosperity will leak through on those below. The Democratic idea has been that if you legislate to make the masses prosperous their prosperity will find its way up and through every class that rests upon it. You come to us and tell us that the great cities are in favor of the gold standard. I tell you that the great cities rest upon these broad and fertile prairies. Burn down your cities and leave our farms, and your cities will spring up again as if by magic. But destroy our farms and the grass will grow in the streets of every city in the country."

Answers

The sentences that shows that the cities needs the farms more than the farms need the cities would be:

great cities rest upon these broad and fertile prairies.destroy our farms and the grass will grow in the streets of every city in the country.

What was the cross of gold speech?

The cross of gold speech can be defined as the speech that was made by William Bryan as he intended to be able to get the speech to serve him two purposes.

First he was in agreement of having silver to be a part of the economy of the United States just as silver was also used at the time.

Also he wanted the speech to be able to get him the nomination as the president from the democratic party.

In the speech we can see the two points that he made on farming. He said that the great cities of the nations relied on the fertile prairie lands and if the people should burn the farms they would have grasses growing on all parts of the cities in the nation.

Read more on cross of gold speech here: https://brainly.com/question/24556525

#SPJ1

Need help quiz is here and this is the only answer I don’t know

Need help quiz is here and this is the only answer I dont know

Answers

Answer:

activation energy is the answer

Which of the following best explains why ligase is required for DNA replication? The lagging strand cannot be replicated continuously, and ligase is needed to join the fragments. Answer A: The lagging strand cannot be replicated continuously, and ligase is needed to join the fragments. A Ligase forms the hydrogen bonds between complementary bases in the two strands of DNA. Answer B: Ligase forms the hydrogen bonds between complementary bases in the two strands of D N A . B

Answers

The correct explanation is A: The lagging strand cannot be replicated continuously, and ligase is needed to join the fragments.

During DNA replication, the two strands of the DNA double helix are unwound, and each strand serves as a template for the synthesis of a new complementary strand. The leading strand is synthesized continuously in the 5' to 3' direction, while the lagging strand is synthesized discontinuously in small fragments called Okazaki fragments, also in the 5' to 3' direction.

After the synthesis of each Okazaki fragment, the RNA primer that initiated the fragment is removed and replaced with DNA by DNA polymerase. However, there are small gaps between the newly synthesized fragments on the lagging strand. Ligase is required to seal these gaps by catalyzing the formation of phosphodiester bonds between adjacent nucleotides, effectively joining the Okazaki fragments together into a continuous strand.

To know more about DNA replication

brainly.com/question/30111562

#SPJ11

a fish that has a skeleton of cartilage but no jaws or paired fins is called a [ select ] . a [ select ] is a jawed fish with a skeleton composed mainly of bone.

Answers

A fish that has a skeleton of cartilage but no jaws or paired fins is called a "agnathan." A "gnathostome" is a jawed fish with a skeleton composed mainly of bone.

Agnathan: Agnathans are a group of jawless fish that have a skeleton made of cartilage. They lack jaws and paired fins. Examples of agnathans include lampreys and hagfish. These fish rely on suction feeding and scraping food particles from their prey.

Gnathostome: Gnathostomes are a diverse group of jawed fish that have a skeleton composed mainly of bone. They possess jaws that enable them to efficiently capture and process food. The majority of fish species, including familiar groups like teleosts, are gnathostomes. The development of jaws and paired fins in gnathostomes allowed for more effective feeding, locomotion, and predation strategies, contributing to their evolutionary success.

To know more about cartilage, refer here:

https://brainly.com/question/29111028#

#SPJ11

pls help fast! im in a test! Select the processes that may be used for composting a manure pile.
watering
aeration
heating
UV light treatment
burning
layering with vegetation

Answers

To guarantee that a manure pile is adequately composted, a number of procedures must be used.

To keep the pile at the proper moisture level and allow oxygen to move throughout, the pile must be watered, aerated, and covered with plants. Heating is essential since it will hasten the composting process.

To assist eliminate any germs that may be in the pile, UV light treatment can also be performed. A manure pile cannot be composted successfully without completing each of these steps.

Learn more about oxygen   at:

https://brainly.com/question/13370320

#SPJ1

in what important way does competitive inhibition differ from allosteric inhibition?

Answers

The important way competitive inhibition differ from allosteric inhibition is competitive inhibition involves competition for the active site, while allosteric inhibition involves regulation by a molecule binding to a different site on the enzyme.

Competitive inhibition and allosteric inhibition are two types of enzyme inhibition that have important differences. Competitive inhibition occurs when a molecule that is similar in shape to the substrate competes with the substrate for the active site of the enzyme. This molecule, called the inhibitor, binds to the active site and prevents the substrate from binding, leading to a decrease in enzyme activity.

In contrast, allosteric inhibition occurs when a molecule binds to a site on the enzyme that is not the active site, causing a conformational change in the enzyme that reduces its activity. This type of inhibition is usually regulated by feedback mechanisms and can have a more significant impact on enzyme activity than competitive inhibition. In summary, competitive inhibition involves competition for the active site, while allosteric inhibition involves regulation by a molecule binding to a different site on the enzyme.

Learn more about enzyme at

https://brainly.com/question/30600790

#SPJ11

1. Bacteria. Two bacteria were placed in a dish. The number of bacteria quadruples every hour. There are now 131,072 bacteria in the dish. How many hours have passed since the original two bacteria we

Answers

To determine the number of hours that have passed since the original two bacteria were placed in the dish, we can use the fact that the number of bacteria quadruples every hour.

Starting with two bacteria, we can observe the progression:

Hour 1: 2 bacteria

Hour 2: 2 x 4 = 8 bacteria

Hour 3: 8 x 4 = 32 bacteria

Hour 4: 32 x 4 = 128 bacteria

Hour 5: 128 x 4 = 512 bacteria

Hour 6: 512 x 4 = 2048 bacteria

Hour 7: 2048 x 4 = 8192 bacteria

Hour 8: 8192 x 4 = 32768 bacteria

Hour 9: 32768 x 4 = 131072 bacteria

Therefore, it took 9 hours for the number of bacteria to reach 131,072.

To solve more questions on bacteria , visit the link below

brainly.com/question/30217998

#SPJ11

Which of these is a segment of DNA that contains the information necessary to produce a protein? A) a codon B) a gene C) a base D) a chromosome

Answers

Answer:

B. A gene

Explanation:

I hope it helps! Have a great day!

How are the layers of rock (strata) helpful in determining the age of the fossils found in them?

Answers

Answer:

The rock layers help by preserving the fossils and it also keeps a record of how they died, where they lived, what they ate, and a million other factors. Most rock layers are trillions of years old and it shows us what was alive and how they lived and what the earth was like back then.

Explanation:

Dimples are dominant over no dimples; freckles are dominant over no
freckles. John has dimples and freckles; his wife Kate does not. They
have a son who has neither freckles nor dimples. State the genotypes of
all three individuals.
D = di

Answers

Explanation:

Mother: dd, Father: DD, and Son: dd

This is the pre-mRNA of a mammalian gene. Mark the splice sites, and underline the sequence of the mature mRNA. Assume that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN. Use / to mark the 5'splice site(s) and \ to mark the 3' splice site(s). There may be more than one 5’ site and 3’ site. N means any nucleotide. (In this problem, there are no branch point A’s, poly Y tracts or alternate splice sites.

Answers

Here is the marked pre-mRNA with splice sites (/ and ) and underlined mature mRNA sequence:

5'-AGCUUCGCGUAAAUCGUAG/GUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAG\GGCUUUGG ACCGAUAGAUGCGACCCUGGAG/GUAAGUAUAGAUAAUUAAGCACAG\GCAUGCAG/GGAUAUCCU CCAAAUAG\GUAAGUAACCUUACGGUCAAUUAAUUAG/GCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAG\GUAAGUCUGAU-3'

In the given pre-mRNA sequence, we are instructed to mark the splice sites and underline the sequence of the mature mRNA. The splice sites are indicated by the symbols "/" and "", representing the 5' and 3' splice sites, respectively.

Analyzing the sequence, we can identify the locations where the splice sites occur. The 5' splice site is indicated by "AG/GUAAGU" and the 3' splice site is indicated by "AG\GN". Since there may be more than one 5' and 3' splice site, we need to mark all the occurrences.

After marking the splice sites, we underline the sequence of the mature mRNA. The mature mRNA is formed by removing the intron sequences, which lie between the splice sites. In this case, the underlined sequence represents the mature mRNA after splicing. The 5' splice site(s) is marked with a forward slash (/), and the 3' splice site(s) is marked with a backslash ().

The underlined sequence represents the mature mRNA after splicing. In this case, the underlined sequence is:

5'-AGCUUCGCGUAAAUCGUAGGUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAGGCUUUGG ACCGAUAGAUGCGACCCUGGAGGUAAGUAUAGAUAAUUAAGCACAGGCAUGCAGGGAUAUCCU CCAAAUAGGUAAGUAACCUUACGGUCAAUUAAUUAGGCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAGGUAAGUCUGAU-3'

This represents the mature mRNA sequence after removing the intron sequences between the splice sites.

To learn more about pre-mRNA, here

https://brainly.com/question/30583590

#SPJ4

Which of these choices most accurately describes how particles move in a transverse wave?
A)particles in the medium move perpendicular and parallel to the direction of the waves
B)the particles in the medium move perpendicular to the direction of the waves
C)the particles in the medium move parallel to the direction of the waves
Or D) particles in the medium move in a circular direction around the wave.

Answers

I’m pretty sure it’s B.
I’m pretty positive that it is B

Figure 6 shows the inheritance of flower colour in two species of plant.
In pea plants and in snapdragon plants, flower colour is controlled by one pair of alleles.
In figure 6 the parental generation plants are hom0zygous for flower colour.
In heterozygous pea plants, the allele for red flower colour is dominant
In heterozygous snapdragon plants, the alleles for flower colour are both expressed.
What is the genotype of the red-flowered pea plants in the F1 generation?
What is the genotype of a white-flowered snapdragon plant?

Answers

In the F1 generation, the red-flowered pea plants have a genotype of Rr, where R represents the dominant allele for red flower color, and r represents the recessive allele for white flower color.

The genotype of a white-flowered snapdragon plant is ww, where w represents the recessive allele for white flower color.

Pea Plants:

The red-flowered pea plants have a genotype of Rr, where R represents the dominant allele for red flower color, and r represents the recessive allele for white flower color.

This means that the red-flowered pea plants have inherited one dominant allele (R) from one parent and one recessive allele (r) from the other parent. The dominant allele (R) determines the red flower color, while the recessive allele (r) does not show its characteristic in the presence of the dominant allele.

Snapdragon Plants:

The white-flowered snapdragon plant has a genotype of ww, where w represents the recessive allele for white flower color. In this case, the snapdragon plant has inherited two recessive alleles (w) from both parents.

Since the recessive allele (w) is present in both copies, the white flower color is expressed in the snapdragon plant.

It's important to note that the information provided only describes the genotypes of the red-flowered pea plants (Rr) and the white-flowered snapdragon plant (ww) in the F1 generation.

It does not provide any information about the phenotypes or genotypes of the other plants in the F1 generation or any subsequent generations.

To learn more about snapdragon, refer below:

https://brainly.com/question/29166482

#SPJ11

Lizard is a poikilothermic animal give reason please​

Answers

Answer:

Both reptiles and amphibians are poikilothermic, which means that they cannot regulate their own body temperatures internally 

Mark Brainliest please

Poikilothermic animals include types of vertebrate animals, specifically some fish, amphibians, and reptiles, as well as many invertebrate animals.

Reptiles are cold-blooded, or ectothermic, animals. This means that they cannot produce heat in their own bodies, and have to rely on their surroundings to keep warm. This is why most reptiles are found in hot or warm climates. Reptiles often bask in the sun to get warm.

Both reptiles and amphibians are poikilothermic, which means that they cannot regulate their own body temperatures internally as birds and mammals do.

6. Which fossil type provides the most anatomical
information to paleontologists?

Answers

Answer:

amber

Explanation:

the amber completely preserves the specimen

The fossil type that provides the most anatomical information is amber

How would you describe an epithelium consisting of a single layer of cells in which all cells rest directly on the basement membrane and all cells reach the apical surface?.

Answers

Columnar epithelium consists of a single layer of cells in which all cells rest directly on the basement membrane and all cells reach the apical surface.

What is a epithelial tissue?

Epithelial tissue has a free surface, which faces either a body fluid or the outside environment and thus provides a covering or a lining for some parts of the body.

There are two types of epithelial tissues namely :

Simple epithelium: Simple epithelium is composed of a single layer of cells and functions as a lining for body cavities, ducts, and tubes.Compound epithelium: The compound epithelium consists of two or more cell layers and has protective function as it does in our skin.

Simple epithelium is further divided into three types, they are;

The squamous epithelium is made of a single thin layer of flattened cells with irregular boundaries. They are found in the walls of blood vessels and air sacs of lungs and are involved in functions like forming a diffusion boundary.The cuboidal epithelium is composed of a single layer of cube-like cells. This is commonly found in ducts of glands and tubular parts of nephrons in kidneys and its main functions are secretion and absorption.  The columnar epithelium is composed of a single layer of tall and slender cells. Their nuclei are located at the base. Free surface may have microvilli. They are found in the lining of stomach and intestine and help in secretion and absorption.

To learn more about epithelial tissues: https://brainly.com/question/13404204

#SPJ2

The paris agreement intends to direct money toward limiting climate change
and lowering greenhouse gas levels. which groups are likely to benefit from
the paris agreement? select the three correct responses.
o a. solar power companies
o b. hydroelectric dam engineers
c. petroleum companies
d. hydraulic fracking operators
e. geothermal reservoir drillers
please help.

Answers

Answer:a,b,

Explanation:

The groups which are likely to benefit from the Paris agreement are solar power companies, and hydroelectric dam engineers. Thus, option A and B are correct.

What is Paris Agreement?

The Paris Agreement deals with production of those types of energy which is clean and which don't emit (or emit very less) green house gasses, the root cause of climate change and global warming.The term climate change has to do with the alteration of weather patterns owing to the release of harmful gases commonly called greenhouse gases.

The main goal of the Paris Agreement is to strengthen the global response to the threat posed by climate change by limiting the rise in global temperature this century to well below 2 degrees Celsius above pre-industrial levels and to pursue efforts to further limit the temperature increase to 1.5 degrees Celsius.

Therefore, The groups which are likely to benefit from the Paris agreement are solar power companies, and hydroelectric dam engineers. Thus, option A and B are correct.

Learn more about global temperature on:

https://brainly.com/question/9089155

#SPJ5

Which is the most likely explanation for the change?​

Which is the most likely explanation for the change?

Answers

Answer:

a beetle population moved to a greener habitat.....

yaar answer da do plzz​

yaar answer da do plzz

Answers

Answer:

U know I need time to make it for changing my is a sentence of measurement? I jump on it. uses of measurement? I jump on it. uses of measurement? I jump on it. uses of

how do weedkillers work?​

Answers

Answer:

the have a special chemical in them causing the plant to descintagrate over time from the special chemical :)

Explanation:

Question:

how do weedkillers work?

Answer:

It works by stimulating growth in the weed that cannot be sustained.

What is Weedkillers?

→Weedkillers are chemical-based liquids that are specifically engineered to target different types of weed in the best way possible. Whatever the weeding job that you are trying to tackle, there is a weedkiller that is matched to that job and will do exactly what you need.

Hopefully Help:)

#CarryOnLearning

The atom shown below is
A. likely to form a covalent bond
o B. likely to form an ionic bond
C. not likely to form any bonds
OD. likely to form double bonds

The atom shown below isA. likely to form a covalent bondo B. likely to form an ionic bondC. not likely

Answers

Answer:

C. Not Likely to form any bonds

Explanation:

Assuming this atom is of neutral charge, it would be neon. We can tell as it has 10 electrons total. 2 in the first shell, 8 in the second. Noble gasses do not  form bonds, generally speaking.

Furthermore, any atom, ion or not, that has a full valance (outermost shell) is generally not likely to form bonds.

The Ethics Behind Assessment. A 19-year-old girl has come in for a routine check-up and has not yet received the Covid vaccine. Her family is very religious and believes that they are covered by their faith.

Write a detailed one-page narrative (not a formal paper) explaining the health assessment information required for a diagnosis of your selected patient (include the scenario number). Explain how you would respond to the scenario as an advanced practice nurse using evidence-based practice guidelines and applying ethical considerations. Justify your response using at least three different references from current evidence-based literature.

Answers

The Ethics Behind Assessment According to the given scenario, the 19-year-old girl is unvaccinated and comes in for a routine check-up.

Her family's religious beliefs prevent her from receiving the Covid vaccine. In order to come up with a diagnosis, the advanced practice nurse would need to collect detailed health assessment data about the patient. This may include any medical history, current medications, family medical history, etc.As an advanced practice nurse, the appropriate response to this scenario would be to explain the risks and benefits of the Covid vaccine and provide accurate information to the patient and her family. The nurse should also provide education on the importance of receiving the vaccine to prevent the spread of the virus and to protect the health of others in the community.

The nurse should also respect the patient's religious beliefs and provide them with resources to help them make an informed decision.In accordance with the ethical principles of autonomy and beneficence, the advanced practice nurse should respect the patient's autonomy by providing accurate information and allowing them to make their own decision. The nurse should also act in the patient's best interest and promote the well-being of the patient and others by recommending the vaccine.In order to support the use of evidence-based practice guidelines in this scenario, the nurse should reference current literature on the safety and effectiveness of the Covid vaccine.

For example, according to a study published in the New England Journal of Medicine, the Pfizer-BioNTech Covid-19 vaccine was found to be highly effective in preventing Covid-19 infections. Another study published in the Lancet found that the vaccine was well-tolerated and had minimal side effects. A third study published in the Journal of the American Medical Association found that the vaccine was effective in preventing severe Covid-19 infections and hospitalizations.In conclusion, the advanced practice nurse should provide accurate information, respect the patient's autonomy, and promote the well-being of the patient and others by recommending the Covid vaccine. By utilizing evidence-based practice guidelines and considering the ethical principles of autonomy and beneficence, the nurse can provide high-quality care that is consistent with the best available evidence.

to know more about unvaccinated visit :

https://brainly.com/question/30872259

#SPJ11

although all of the cells in your body contain a complete set of dna, different cells have different functions because .

Answers

Despite having a full set of DNA, each type of cell in your body has a different function because various genes are turned on and off in that type of cell.

Even though all the cells in a multicellular organism have the same DNA, they may express quite diverse gene sets. A cell's distinctive characteristics are determined by the collection of proteins and functional RNA that are expressed from the set of genes in that cell. Because they create and accumulate various collections of RNA and protein molecules, the various cell types in a multicellular organism become distinct from one another. Typically, they do this without changing the DNA's sequence.

To learn more about gene click here:

https://brainly.com/question/29367774

#SPJ4

Which crops would be the best after the catastrophic event? No links or improper answers!

Which crops would be the best after the catastrophic event? No links or improper answers!

Answers

I would pick strawberries because they reproduce straight-ly and ace-ly. It will be a good idea to reproduce the strawberries straight-ly with bees for genetic diversity. You'll end up with strawberries like this:

Which crops would be the best after the catastrophic event? No links or improper answers!

the concentration of carbon dioxide in the atmosphere has been increasing for many years, how might this increase affect photosynthesis

Answers

Answer:

the answer is

Carbon dioxide concentrations are rising mostly because of the fossil fuels that people are burning for energy.Increasing the light intensity increases the rate of photosynthesis, until some other factor  a limiting factor  becomes in short supply. At very high light intensities,photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

Explanation:

Other Questions
What does it mean when a company is a Delaware corporation? I cant figure this out please help Approximately ________ of exertional heatstroke victims are sweating.a. 40%b. 50%c. 60%d. 70% How is the Titanic movie an example of Romanticism? While cultural differences should always be considered, which industry should be especially aware of traditions when trying to enter a foreign market After moving to Greenland last January, Felicia has had little energy. She also feels sad, tired and unable to sleep. Felicia also has no interest in activities that she used to love. Felicia likely would be diagnosed with: Select one: a. Seasonal affective disorder. b. Bipolar disorder. c. Persistent depressive disorder. d. Generalized anxiety disorder. PQ is parallel to RS. PR and QS are perpendicular to PQ and RS. The ratio of the lengths of PR and QS is How a commitment to a decision could assist school leaver to adapt to the Change of entrepreneurship THE IMPORTANCE OF INFORMATION IN MARKETING find the vertex focus and directrix of the parabola given theequation and graph the equation getting at least two additionalpoints8. Find the vertex, focus, and directrix of the parabola given by the equation y +6y+8x+ 25 = 0, then graph the equation by getting two at least two additional points besides the vertex. 410 Vertex what are the slope and y intercept of the linear function graphed to the left PLEASE HELP DUE IN 13 MINS ILL GIVE BRAINLIEST ; Why are the executive departments considered the most powerful of the federal bureaucracy groups? A. The head of each executive department acts independently of the president. B. The head of each executive department advises the president directly. C. The executive departments control the largest budgets in the government. D. The executive departments can override the policies set by congress. Gabe is competing in the motocross AMA National championship! In planning his ride, he notices that he can use special right triangles to calculate the distance for parts of the track. Use the image below to help Gabe calculate the distances for sides WY, YX, and YZ. Match A B and C to the correct letters.A. 7 square root (2)B. 14C. 71. WY2. YX3. YZ the circumference of the front tire on john's bike is 6 feet. how many turns does the front wheel make as john rides down his 30-foot-long driveway? a nursing student studying pharmacology is focusing on drugs used to treat tuberculosis (tb). this student correctly identifies the classifications of antitubercular drugs as which of the following? A cylinder has a volume of 320 pi cubic inches and a height of 5 inches what is the radius How do you write a claim statement for an argumentative essay? Your testing a new drug to treat a serious, often fatal medical condition. Before your experiment is over, it becomes obvious that the drug is working so well that the people in the experimental group are going to recover completely. Should you stop the experiment to give the drug to the people on the control group? a runoff election is most likely to occur in which kind of electoral system? What technique is used in this phrase the witch lived in a cold, cramped cave with her cunning cat