If an investment adviser is an individual, which of the following items would be included in the computation of adviser's net capital?
A Goodwill
B Automobile
C Accounts receivable
D Copyright

Answers

Answer 1

If an investment adviser is an individual, the items which would be included in the computation of the adviser's net capital include goodwill, accounts receivable, and copyright.

If an investment adviser is an individual, the computation of the adviser's net capital would include goodwill, accounts receivable, and copyright. The term net capital refers to the difference between the total assets and total liabilities. It is an essential term in the accounting field. Net capital is calculated using the financial information in the balance sheet of an organization. If an investment adviser is an individual, then goodwill, accounts receivable, and copyright will be included in the computation of the adviser's net capital. Goodwill is an intangible asset that reflects the reputation of a company, its customer relations, and its brand value. Accounts receivable is an asset that represents the amount of money that customers owe the company. Copyright is an intangible asset that is used to protect original works of authorship such as books, songs, and artwork.

Learn more about computation here:

https://brainly.com/question/11530040

#SPJ11


Related Questions

What is the most important value in "Patagonia company" among effectiveness, efficiency, equity? Why?

Answers

The most important value in Patagonia company is equity. This is because Patagonia is committed to creating a more just and equitable world, and they believe that businesses have a responsibility to use their power to make a positive impact.

Patagonia's products are designed to be durable and long-lasting, which helps to reduce waste. They also source their materials from sustainable sources, and they work to reduce the environmental impact of their manufacturing process.

Patagonia's workplace practices are also designed to be equitable. They offer fair wages and benefits to their employees, and they promote diversity and inclusion in the workplace.

Patagonia's commitment to equity is also evident in their environmental initiatives. They work to protect the environment through their products, their workplace practices, and their financial support of environmental organizations.

For example, Patagonia has a program called "Common Threads Initiative" that helps to reduce the environmental impact of clothing production.

In conclusion, equity is the most important value in Patagonia company because it is the foundation of their commitment to social and environmental responsibility.

Patagonia believes that businesses have a responsibility to use their power to make a positive impact, and they are committed to creating a more just and equitable world.

Visit here to learn more about equity:

brainly.com/question/30761849

#SPJ11

Business analytics uses _____ to gain insight into data and provide decision makers with information they can act on.

Answers

Predictive Modelling is used in Business Analytics to get insight into data. Decision-makers in turn rely on the information provided for steering the direction of the organization.

What is Predictive Modelling?

It should be noted that this is a mathematical process that is utilized in the prediction of future events based on historical data which have been analyzed.

Travelling Data for 2021, for example, maybe collected from Airlines in a particular city in the US and analyzed to see how much traveling people are likely to do in 2022 using tools such as time-series regression models.

See the link below to learn more about Predictive Modelling:

https://brainly.com/question/13162779

Pat and his friend rent an apartment together. Their total cost to move in included first month's rent, last month's rent and a security deposit of $600. If Pat paid a total of $1,050 to move in, how much is his share of the rent each month?.

Answers

Pat and his friend rent an apartment together. Their total cost to move in included the first month's rent, last month's rent, and a security deposit of $600. If Pat paid a total of $1,050 to move in,

Explanation: We know that he and his friend rent an apartment together. Their total cost to move in included the first month's rent, last month's rent, and a security deposit of $600.Pat paid a total of $1,050 to move in. We have to find Pat's share of the rent each month. We will begin by calculating the total amount of rent they paid to move in. It is calculated by subtracting the security deposit from the total amount paid to move in. So, Total rent paid = Total amount paid - Security deposit= $1,050 - $600= $450Now, we know that the total rent for the apartment is split between Pat and his friend. Therefore, we can divide the total rent by two to find each of their shares:$450 ÷ 2 = $225Therefore, Pat's share of the rent each month is $225.

to know more about rent here:

brainly.com/question/31328486

#SPJ11

To solve this problem, you will need to build your own formulas concerning changes in total revenues as discussed in the book. You are the manager of a firm that receives revenues of $20,000 per year from product X and $80,000 per year from product Y.The own price elasticity of demand for product X is -3, and the cross-price elasticity of demand between product Y and X is -1.6. Question: How much will your firm's total revenues (revenues from both products) change if you increase the price of good X by 2 percent? Revenues per year from product X Revenues per year from product Y $20,000 $80,000 -3 -1.6 2 Own price elasticity of demand for product X Cross-price elasticity of demand between products X and Y Price increase of product X (percent) Change in total revenues

Answers

if the price of good X is raised by 2%, the total revenues from both goods will decrease by 9.2 percent.

The own price elasticity of demand for product X is -3, while the cross-price elasticity of demand between product Y and X is -1.6, and revenues from both products are $20,000 per year for product X and $80,000 per year for product Y.

In this case, we want to find out how much your firm's total revenues (revenues from both products) will change if you increase the price of good X by 2%.

We'll use the following formula to determine the percentage change in the quantity demanded:% Change in Quantity Demanded = % Change in Price × Own Price Elasticity of Demand

Here, we'll have to use the own-price elasticity of demand for product X, which is -3, to calculate the percentage change in the quantity demanded.% Change in Quantity Demanded = 2% × (-3) = -6%This indicates that if the price of product X is increased by 2%, the quantity demanded will decrease by 6%.

We can now use the following formula to calculate the percentage change in the total revenues: % Change in Total Revenues = % Change in Quantity Demanded + Cross-price Elasticity of Demand × % Change in Price

Let's put the values of our terms into the formula to calculate the percentage change in the total revenue.% Change in Total Revenues = -6% + (-1.6) × 2% = -9.2%

To learn more about total revenues click here:

https://brainly.com/question/30760779#

#SPJ11

why am i never hungry?

Answers

The condition of never feel hungry comes under the possible cause of loss appetite in which your appetite might also be suppressed by hormonal changes, a persistent disease, and drugs.

What do you understand by the loss of appetite?

A lack of appetite is a symptom with a wide range of potential explanations. When you are not hungry, this happens. Anorexia is the medical word for a lack of appetite. Compared to the eating disorder anorexia nervosa, this is distinct.

Anxiety, depression, and stress are a few mental health problems that can negatively impact appetite levels. A decrease in appetite can also be brought on by other medical issues, including pregnancy, hypothyroidism, and more.

Lack of appetite can occasionally be an indication of other illnesses, such as hypothyroidism, diabetes, or even cancer.

Therefore, the condition of never feel hungry comes under the possible cause of loss appetite in which your appetite might also be suppressed by hormonal changes, a persistent disease, and drugs.

To know more about the loss of appetite, visit:

https://brainly.com/question/23077678

#SPJ1

25 points, Why are certain brands global? 3-4 sentences, please.

Answers

Answer: Certain Brands can be global because of their profits, Let's take cars for a example, Cars can be made and distributed based on the company if they can pay for all the shipping and everything, but it really depends on the company and what they are selling.

Explanation:

If you were to apply for an administrative personnel position, what might you explain about yourself so that you sound qualified for the job?

“I am good at coming up with meal plans for the office.”

“I am good at filing and organizing paperwork.”

“I am good at replacing light bulbs when they burn out.”

Answers

i am good at filing and organizing paper

Answer:

b

Explanation:

To calculate the number of montly payments required to pay off a loan or meet an investment goal, use the _______ function.

Answers

To calculate the number of monthly payments required to pay off a loan or meet an investment goal, use the nper function.

In finance, lending is the lending of money by one or more individuals, organizations, or other entities to other individuals and organizations, etc. The beneficiary incurs a debt and usually has to pay interest on that debt until that debt is also repaid. to repay the principal borrowed.

The promissory note will typically state, among other things, the principal amount of the loan, the interest rate charged by the lender, and the date of repayment. A loan involves reallocation of assets in question over a period of time, between the lender and the borrower.

To know more about loan here-

https://brainly.com/question/11794123

#SPJ4

A special type of team formed to devise, design, and implement a new product is a ______.
task force
quality-assurance team
product-development team
project team

Answers

The special type of team formed to devise, design, and implement a new product is a product-development team. A product-development team is a group of individuals with diverse skills and expertise who work together to create, design, and implement a new product.

This team is responsible for identifying customer needs, conducting market research, generating ideas, prototyping, testing, and launching the final product. The product-development team members come from different departments such as marketing, engineering, design, and manufacturing. They work collaboratively, each contributing their specialized knowledge to ensure the product meets customer needs and is competitive in the market. The product-development team is responsible for every aspect of the product's development, from concept to launch, including managing timelines, budgets, and resources. By working together, the team can ensure the product is of high quality, meets customer expectations, and is profitable for the company.

To know more about product-development visit :

https://brainly.com/question/16529144

#SPJ11

Assume that the oil extraction company needs to extract Q units of oil (a depletable resource) reserve between two periods in a dynamically efficient manner. What should be a maximum amount of Q so that the entire oil reserve is extracted only during the 1st period if (a) the marginal willingness to pay for oil in each period is given by P = 26 - 0.5q, (b) marginal cost of extraction is constant at $3 per unit, and (c) discount rate is 1%?

Answers

To determine the maximum amount of oil reserve, Q, that should be extracted only during the 1st period, we need to compare the marginal cost of extraction with the marginal willingness to pay for oil in each period.

(a) The marginal willingness to pay for oil in each period is given by P = 26 - 0.5q, where q represents the quantity of oil extracted in each period.

(b) The marginal cost of extraction is constant at $3 per unit.

(c) The discount rate is 1%.

We want to maximize the total present value of revenue from oil extraction. The present value of revenue can be calculated using the formula:

PV = Σ [(P - MC) / (1 + r)^t],

where PV is the present value of revenue, P is the price per unit, MC is the marginal cost per unit, r is the discount rate, and t is the time period.

Since the marginal cost of extraction is constant at $3 per unit, MC = $3.

Using the formula for marginal willingness to pay, we have P = 26 - 0.5q.

Substituting the values into the present value formula, we get:

PV = Σ [(26 - 0.5q - 3) / (1 + 0.01)^t],

where the summation is taken over the 1st period.

To maximize PV, we want to extract the maximum amount of oil reserve, Q, only during the 1st period. This means the summation will include all values of q from 0 to Q.

To find the maximum value of Q, we need to determine the point at which extracting any additional unit of oil in the 1st period would result in a lower present value.

Therefore, we need to find the value of Q where the marginal willingness to pay, 26 - 0.5Q, is equal to the marginal cost, $3.

26 - 0.5Q = 3,

Solving for Q:

0.5Q = 23,

Q = 46.

Hence, the maximum amount of oil reserve, Q, that should be extracted only during the 1st period is 46 units.

To know more about marginal visit-

brainly.com/question/31198163

#SPJ11

Which component of a balance sheet includes a business’s debts, or the money that it owes to creditors for past transactions?

Answers

Answer:

liabilities.

Explanation:

A balance sheet is prepared based on the accounting equation of assets = capital + liabilities.

The liability section is where the debts of the business are recorded. Liabilities represent what the business owes to suppliers and other third parties. They are expressed in monetary value. Liabilities are further subdivided into current and long term liabilities.

During civil lawsuit proceedings regarding alcohol service, courts will try to determine if the
designated driver was present and remained sober. guest's BAC was checked throughout the evening. server recently attended proper alcohol training, server contributed to the injury.

Answers

Courts will attempt to ascertain if the designated driver was there and stayed sober throughout civil lawsuit proceedings over alcohol service.

A lawsuit is a legal action brought by one or more plaintiffs or claimants against one or more defendants. Only a limited number of laws from long ago that are still in force include the phrase "suit in law." The term "lawsuit" refers to a civil action that is launched by a plaintiff—a party who alleges that they have suffered loss as a result of the defendant's actions—and in which the plaintiff asks the court for either a legal remedy or an equitable remedy.

To learn more about lawsuit proceedings refer here:

https://brainly.com/question/14310615

#SPJ4

Sometimes news organizations have biases because:
A. they are concerned about a national crisis.
B. the government pays them to be biased.
C. they need to make money and get advertisers.
D. the audience has to be influenced.

Answers

Answer:

c

Explanation:

Sometimes news organizations have biases because they need to make money and get advertisers. Hence, option C is correct.

What is organizations?

a group of people who work together in an organized way toward a common objective: the World Health Organization. The essay was about international aid organizations. more occurrences.

A structured grouping of people, such as a company, nonprofit, political party, or club, is known as an organization. These speciality schools are mostly run by nonprofit organizations. a report from the International Labor Organization.

The majority of firms today use one of three types of organizational structures: functional, departmental, or matrix. The advantages and disadvantages of each form must be considered by owners before deciding which to utilize for their business.

Thus, option C is correct.

For more information about organizations, click here:

https://brainly.com/question/12825206

#SPJ5

What is the goal of materials handling? a. Minimize length of time product is held in storage b. Minimize time spent sorting delivered products c. Minimize the time spent coding and tagging products d. Minimize the number of times a product is handled e. Minimize the number of times a product is transported

Answers

Answer:

d. Minimize the number of times a product is handled

Explanation:

Material handling is the process by which products are passed from different stages of production and delivery before getting to the consumer.

Since material handling is an essential activity in production businesses plan to reduce cost on this activity.

The best way to reduce handling cost is to reduce the number of time a product needs to be handled.

That is reducing to the barest minimum the touch points in process like sorting, moving, preparing, and storing products

Perform online research and find a house you would like to own. Calculate the cost of utilities, services, maintenance, and insurance to buy the home.

Answers

(Answers may vary.)

I found an apartment in Chicago that I would like to rent. The monthly rent is $900, but there are other fees for me to consider as a renter. Utilities (electric, water, cable, internet access, etc.) cost $300 a month. Building services, including parking and access to the gym, cost $50 a month. Maintenance fees for the building are $25 a month. Renter’s insurance is $12. The cost of living independently in this Chicago apartment is $1,287 a month.

Explanation: edmentum sample answer

Which of the following is the type of supplier integration where suppliers establish manufacturing facilities closeby?
a. Collaborative forecasting
b. Vendor managed inventory
c. Insourced warehousing
d. Early supplier involvement in NPD
e. Supplier-integrated manufacturing

Answers

The correct answer is e. Supplier-integrated manufacturing. In this type of supplier integration, suppliers establish their manufacturing facilities in close proximity to the buyer's facilities.

This arrangement allows for better coordination, communication, and sharing of resources between the buyer and the supplier. It enables faster response times, reduced transportation costs, and increased supply chain efficiency. By locating manufacturing facilities nearby, both parties can collaborate closely, streamline production processes, and optimize the flow of goods, leading to improved quality control, lower lead times, and enhanced overall operational performance. Supplier-integrated manufacturing promotes stronger partnerships and facilitates a seamless integration of the buyer's and supplier's manufacturing capabilities.

Learn more about manufacturing here:

https://brainly.com/question/29489393

#SPJ11

Customer: "with all of the money i am spending today, will i be receiving anything complimentary?".

Answers

If someone has money in the bank but is unable to spend it, then the money is useless and cannot be used to benefit them in any way. In light of what was said in the Stag and the Antlers narrative.

Money kept at a bank is referred to as a deposit in the world of finance. A deposit is a deal in which money is given to someone else to keep safe. A percentage of money used as security or collateral for the delivery of a good can also be referred to as a deposit.

The use of a portion of the cash as a security or as collateral for the delivery of a good is the alternative definition of a deposit. As a sign of good faith, some contracts call for a portion of the money to be paid before delivery. For instance, brokerage companies frequently demand that traders deposit initial margin funds before entering into a new futures contract.

To learn more about money refer here:

https://brainly.com/question/14253896

#SPJ4

positioning describes a company's offering relative to the product attributes that are most important to whom?

Answers

Yes, the statement "positioning describes a company's offering relative to the product attributes that are most important to whom" is accurate. positioning describes a company's offering relative to the product attributes that are most important to its target audience.

Positioning refers to the perception that a customer has about a company's products and services compared to its competitors. It can be defined as the strategic marketing process of deciding how to present a product or service to the target audience in a way that distinguishes it from other similar products.

Positioning involves determining the unique selling proposition (USP) of a company's products and services. It also involves understanding the needs of the target audience and tailoring the messaging to address those needs. The most crucial product attributes are those that are relevant to the target audience. The company should identify the key attributes that appeal to its target audience and emphasize those in its messaging.

Therefore, positioning describes a company's offering relative to the product attributes that are most important to its target audience.

to know more about Positioning visit :

https://brainly.com/question/11226413

#SPJ11

A contractual agreement between two companies in which one company gives the other company, in exchange for a lump sum and royalties, the right to operate a retail outlet using a name and format developed by the first company is referred to as ______. Multiple choice question. multi-level marketing licensing franchising retailing

Answers

The contractual agreement described above which is a way of expanding a business venture, is referred to as franchising.

Franchising involves:

A company allowing another company to use its name and brand The company gaining the license paying the original company royalties for the duration of the contract

In this scenario, a company is paying another company a lump sum and royalties and in exchange, they get to use the name and format of the original company.

This is synonymous with a franchise so we can conclude that this is franchising.

Find out more at https://brainly.com/question/3032789.

You have been hired by a local manufacturing plant to head their human resources department. This company started as a family owned business and slowly grew from only having a small staff of 4 to close to 125 employees. However, the company has not formally stated it’s vision or mission statements. Consequently, the organization has suffered many losses as a result of poor decision making. The plant manufactures wired headphones and they have noticed a decrease in the demand which could be the result of changing technology. As the new Director of Human Resources what steps do you need to take in order to ensure the longevity of the organization?
The question is:
• HR Strategy – determine a HR approach based on any corporate strategy

Answers

As the new Director of Human Resources, it is crucial to align the HR strategy with the overall corporate strategy to ensure the longevity of the organization. Here are the steps you should take:

Understand the Business Strategy: Gain a deep understanding of the company's current and future business strategy. Identify the key goals, objectives, and challenges the organization is facing, including the impact of changing technology on the demand for wired headphones. Conduct a Needs Assessment: Conduct a comprehensive needs assessment to identify the HR requirements and gaps in the organization. This involves assessing the current workforce, their skills, competencies, and capacity to meet the organization's strategic goals.

Learn more about organization here;

https://brainly.com/question/12825206

#SPJ11

1. if reeby sports did go public, what should its shares sell for today? 2. is george reeby correct in his suspicion that book value is not necessarily a good guide to how much the shares are worth?

Answers

1. The price of Reeby Sports' shares if it went public today would depend on a variety of factors, including the company's financial performance, market demand for the shares, and the overall state of the stock market. Without more information, it is difficult to accurately determine what the shares should sell for today.

2. George Reeby is correct in his suspicion that book value is not necessarily a good guide to how much the shares are worth. Book value is simply the difference between a company's assets and liabilities, and does not take into account other factors that may affect the value of the shares, such as the company's future growth potential or the overall state of the stock market.

Therefore, it is important to consider other factors in addition to book value when determining the worth of a company's shares.

Know more about stock market here:

https://brainly.com/question/13400473

#SPJ11

Doug Smith is the manager at Fun in the Sun, a beach and summer clothing store, and he is wanting to sell the shop’s entire line of beach flip flops for $10.50 — the original retail price of the flip flops was $15.00. How much did Doug have to mark down to achieve the sale price and what was the percentage markdown?

Answers

Answer:

$4.50 : and 30%

Explanation:

Markdown signifies a price reduction.

At Fun in the Sun, the original retail price for flip flops was $15. The manager wants to sell at $10.50.

The markdown will be the original price - the new proposed price

=$15 - $10.50

=$4.50

As a percentage, the markdown will be

=$4.50/$15 x 100

=0.3 x 100

=30%

why is it important to know the different phases of economic development​

Answers

yes it is important

Explanation:

It is very important to know changes in different phases of economic development because several things are changed when you are comparing now with past. This is important to know help us compare how we are now and with present.Wheather we are developed or not it helps to know all the aspects.

Economic development is increase in the income and standard of living of people.

it is important to know the different phases of economic development in order "to determine how best to move to the next phase of development".

Stages of economic development according to Rostow:

Traditional stage: This is the first stage characterised by the non - existence of science and technology in an economy.

Precondition to take off: This stage comprises mainly basic changes in the social, political and economic fields.

Take off stage: This is a period in which you investment rate increases which increases the real output per capita.

Drive to maturity: In the stage, total capital per head increases as the economy grow.

Age of high mass consumption: The per capita real income increases at this stage. A higher percentage of the population can afford consumption beyond the basic food, shelter and clothing.

Therefore, it is important to know the different phases of economic development in order "to determine how best to move to the next phase of development".

Read more:

https://brainly.com/question/23514580

the perimeter of an isosceles trapzium is 134 cm and the bases are 54cm and 30cm in length. find the length of nonparallel sides of the trapzium and it's area.​

Answers

Answer:

perimeter of trapezium=134cm

let the trapezium be ABCD in which AB and CD are parallel sides and AD and BC are non parallel sides.

then AB=54cm and CD=30cm

AD=BC

perimeter of trapezium=134cm

AB+BC+CD+AD=134

AD+AD+54+30=134

2AD=50

AD=25cm

Hence non parallel sides which are of equal length =25cm

Explanation:

Last week pauline worked 35 hours and made $280 how much money did pauline make per hour

Answers

8$ per hour per 35/280

Pauline earns $8 per hour for his work.

What is a paycheck?

A wage or salary check made out to an employee by the employer, or a wage or income for employment.

Given=

Pauline worked=35 hours

Pauline earned=$280 in total

so he earns per hour=$280/35 hrs

                           =$8 per hour.

Therefore, he earns $8 per hour.

Learn more about paycheck here:

https://brainly.com/question/25533215

what country consumes the most ice cream per capita?

Answers

The country that is the highest consumer of ice cream per capita is New Zealand.

What is per capita?

Per capita is the statistical unit to measure anything with respect to the average per person.

According to the latest scenario, New Zealand is the country where ice creams are most consumed by people and it is about 28.4 per capita liters every year. After this, the country of the US and Australia also consumed most ice creams in a year with 20.8 per capita liters and 18 per capita liters every year.

Therefore, New Zealand is the largest ice cream consumer country in the whole world.

Learn more about the per capita in the related link:

https://brainly.com/question/14396320

#SPJ4

What resource outlines documentation requirements for MTM services, participation guidelines and other critical program information for OutcomesMTM

Answers

Answer: Policy & Procedure Guide

Explanation:

It should be noted that the MTM services can be performed by licensed pharmacist who have completed an outcomesMTM training or the students who are sounder a licensed pharmacist supervision.

Policy & Procedure Guide outlines documentation requirements for MTM services, participation guidelines and other critical program information for OutcomesMTM.

A government spends money in order to:
A. influence which products will be available to U.S. consumers.
B. make sure government programs can function properly.
C. prevent foreign businesses from competing with U.S. companies.
D. decide what each employee at a U.S. company will be paid.
BMIT

Answers

Answer:

Options A and C is not related at all. I belive It's B.

1 of 5) What does it mean to "Diversify" your portfolio?
A. To hold more than 1 stock
B. For your stocks to not be all in the same area of the economy
C. To have a mix between stocks, mutual funds, or other securities
D. A and B

Answers

Answer:

D. A and B

Explanation:

How much money is there in the world?

Answers

Answer:

nobody don't have any ideas✓✓

All of this depends on currencies in different in countries because it's all worth different amount like 1 US dollar is 0.76 Pounds.

An average for you in USD is 1.4 quadrillion dollars.

Other Questions
the questions are in the pdfs i really need help please answer all requirements and follow any rounding or wholenumber instructionsIntel Textiles Company makes silk banners and uses the weighted average method of process costing. Direct materials are added at the beginning of the process, and conversion costs are added evenly dur please answer thisss What is the equation of the line written in general form? -3x - y 2 = 0 3x - y - 2 = 0 3x y - 2 = 0 Oliver is buying a new dishwasher. The dishwashers price is $285.10 after tax. He has a few payment options. He can put it on his debit card, which would take the money from his savings account. His savings account earns interest at a rate of 1.8% annually. He could also put it on one of two different credit cards. Card A has an annual interest rate of 9%, charged monthly, and charges a flat 1.2% fee on the initial value of the purchase (note: the fee accrues interest too). Card B has an annual interest rate of 12%, charged monthly, but no fee for purchases. Oliver thinks it will take five months for him to earn the additional money to offset the purchase. In all cases, the interest accrues according to this equation: A = P(1 + r)n, where A is the final dollar amount, P is principle (initial amount borrowed), r is the interest rate for each interest period, and n is the number of interest periods. If Oliver withdraws $285.10 from his savings account to make the purchase, how much would he have earned in interest on that amount over five months? Round your answer to the nearest cent. A client who takes theophylline for asthma is experiencing theophylline toxicity. Which of these may be a contributing factor? (Select all that apply) Translate the following expression the product of a number and 3 decreased by 5 Allison just lit a new candle and then let it burn all the way down to nothing. The initial length of the candle was 15 inches and the candle burned at a rate of 0.75 inches per hour. Make a table of values and then write an equation for L,L, in terms of t,t, representing the length of the candle remaining unburned, in inches, tt hours after the candle was lit. 6. Write the sequence of the mRNA transcript that corresponds to the following gene segment of duplex DNA; indicate which of the two sequences represents the coding strand. Initiation site 5'TATAATGCGCCCATCATGCCGCTAGATTAGA3' 3'ATATTACGCGGGTAGTACGGCGATSTAATCT5' Help with this Spanish question A firm has marginal revenue = 50-4x and marginal cost = -20+2x. The firm suffers a lost of 200 rs when no units are sold. Determine the profit function How many triangles in a 15 sides polygon ? PromptUse the passage below to answer parts A, B, and C of the question that follows."The plague frightened and killed. It began in the land of darkness. Oh, what a visitor! It has been current for fifteen years. Chinawas not preserved from it nor could the strongest fortress hinder it. The plague afflicted the Indians in India. It weighed upon theSind. It seized with its hand and ensnared even the lands of the Uzbeks. How many backs did it break in what is Transoxiana! Theplague increased and spread further. It attacked the Persians, extended its steps to the land of the Khitai, and gnawed away at theCrimea. It pelted Rm with live coals and led the outrage to Cyprus and the islands. The plague destroyed mankind in Cairo. Its eyewas cast upon Egypt, and behold, the people were wide-awake. It stilled all movement in Alexandria. The plague did its work like asilkworm. It took from the tiraz factory its beauty and did to its workers what fate decreed."Ibn al-Wardi, "Essay on the Report of the Pestilence," Aleppo, Syria, 1348.A) Identify ONE way the plague spread through Eurasia and affected areas described in the passage.B) Identify ONE way the events discussed in the passage affected economies in Eurasia.C) Identify ONE way the events discussed in the passage affected social structures in Eurasia. there are two roads to climb a mountain one is 400m from north side and other is 800m from south.which road is easier to climb and why? In mortgage lending, a borrower is required to pledge specific real property as security (collateral) for the loan in a practice called? consider an lc-3 system where the stack pointer is initialized to xc000. suppose we push 5 one-word values (e.g., integers) onto the stack. what is the value of the stack pointer now? please help me solve this my grade depends on it I'll give points Enter the next three numbers of the repeating decimal produced by the fraction 5/6.0.833333... solve for brainliest, 20 points, and thanks! Tell whether the conditional is true (T) or false (F). (3^(2)#16) -> (5+5 =10)The conditional is ____ becausethe antecedent is____ and the consequent is ____