Jorge necesita saber a cuantos grados Fahrenheit esta la temperatura, pero el servicio meteorológico la indica
en grados centígrados, ayúdale a resolverlo. Formula F=(9/5*C) +32
·HACERLO EN ALGORITMO

Answers

Answer 1

Answer:

Eso es fácil hermano de matemáticas. Solo haces 9/5 veces c = 18/25 + 32 = 67

Explanation:


Related Questions

The 9/11 commission recognized the need to expand broadband, and did so by switching the current signaling to:
A. fios
B. analog
C. digital
D. DLP

Answers

The 9/11 commission recognized the need to expand broadband, and did so by switching the current signaling to analog. The correct option is B.

What is analog signal?

An analog signal is any guidance that represents another quantity, i.e. one that is analogous to another quantity. In an analog audio signal, for example, the instantaneous signal voltage varies with the pressure of the sound waves.

It first appeared in computer language in 1946 as an adjective to describe a continuous-amplitude signal. A digital signal has since largely replaced it.

Broadband transmission employs analog signaling to send analog signals.

Thus, the correct option is B.

For more details regarding analog signal, visit:

https://brainly.com/question/14825566

#SPJ1

What does the acronym SMART stand for

Answers

Specific, Measurable, Achievable, Relevant, Time-bound

When the Credit Card Number box and the CSC box receive the focus, a transition effect should appear that slowly adds a glowing brown shadow around the boxes. The glowing brown shadow appears but without a transition effect. Return to the code8-4_debug.css file and study the code that applies a transition effect to both the input#cardBox and input#CSC objects, and the input#csc:invalid style. Correct any mistakes you find in the code. Verify that when the Credit Card Number and CSC boxes receive the focus a transition effect appears that adds the glowing brown shadow to the boxes.

Answers

Answer:

dire ako maaram hito because dire ako baltok

medyo la

phases the IT Manager will have to consider in implementing a new information
system for the company

Answers

Here are some of the phases an IT Manager may have to consider during the implementation:

Planning

Analysis

Design

Development

What is the role of the IT Manager?

Implementing a new information system for a company can be a complex and multi-step process.

Planning: This involves defining the goals and objectives of the new information system, identifying stakeholders, analyzing business requirements, and establishing a project plan.

Analysis: In this phase, the IT Manager will assess the current system's strengths and weaknesses, gather user requirements, and determine how the new system will address business challenges and opportunities.

Design: Based on the requirements gathered during the analysis phase, the IT Manager will create a detailed design for the new system, including specifications for hardware, software, and user interfaces.

Development: In this phase, the actual system is built, configured, and tested to ensure that it meets the design specifications and user requirements.

Lastly, Testing: The IT Manager will need to perform comprehensive testing of the new system to ensure that it works as expected, is reliable, and meets the business needs.

Read more about IT Manager here:

https://brainly.com/question/24553900

#SPJ1

You will develop a set of policies that should be clear enough and detailed enough that lawmakers could use them as the basis for drafting new legislation and carmakers could use them as guides for developing new self-driving algorithms for their automobiles.

Draft 5-10 new policies around autonomous technology using the prompts above, and explain why those laws should be implemented.
- Clearly describe the conditions/scenarios to which the policy applies and does not apply.
- Clearly state how difficult decisions, such as in the "trolley problem", should be made according to your policy.
- Focus on how to determine what the "correct" decision is and how that decision might be enforced, both in law and in code.

Answers

The two policies that are created based on the given question is given below:

The Policies

Policy 1: Human Life Above All

This policy applies to all autonomous vehicles and necessitates that the safety of human life be prioritized over any other matter. Consequently, when an accident is expected to ensue, the vehicle should take action so as to diminish harm directed towards alive existence; even though it implies jeopardizing the safety of its own occupants. The trolley problem must be settled in a way that negligent suffering to human life is minimal, and such decision should abide by set rules predetermined by manufacturer and approved by respective regulatory agencies. To ensure that guidelines are abided by, strict fines ought to be imposed for violations occurred.

Policy 2: Transparency and Responsibility  

This policy requires autonomous vehicles to provide transparency about the evolving of decisions and be held responsible for their proceedings. For this purpose, concerning their functioning, tracking and recording each data relating to them is essential, from sensor details to algorithms that determine decisions to overrides made through human manipulation. Manufacturers must furnish clear information of how rationales transpire and what precautionary approaches are utilized for protection. In cases of crashes or accidents, all related info shall be exposed to both governmental organizations responsible for regulation as well as public citizens to make sure transparency and accountability prevail. To guarantee adherence to these regulations, conducting regular reviews and foreboding rigid penalties shall be obligatory contemplation.

Read more about policies here:

https://brainly.com/question/6583917

#SPJ1

What will happen if you delete system32?

Answers

Search Results
Featured snippet from the web
System32 contains critical system files , software programs and they are essential to boot operating system . So deleting it will cause system failure and nothing will work properly . And if you restart your pc then it wont boot at all. You will have to do a clean reinstall to fix things up again .

We can sell the Acrobat Reader software to the other users”. Do you agree with this statement? Justify your answer.

Answers

No, as a User, one CANOT sell Acrobat Reader software to the other users.

What is Adobe Reader?

Acrobat Reader   is a software developed by Adobe and is generally available as a free   PDF viewer.

While individuals can use Acrobat Reader for free,selling the software itself would be in violation of   Adobe's terms of use and licensing agreements.

Therefore, selling Acrobat Reader to other users would not be legally permissible or aligned with Adobe's distribution model.

Learn more about Adobe Reader at:

https://brainly.com/question/12150428

#SPJ1

The security administrator for Corp.com. You are explaining to your CIO the value of credentialed scanning over non-credentialed scanning. In credentialed scanning, policy compliance plugins give you which advantage?

Answers

In credentialed scanning, policy compliance plugins give you an advantage  known as option C: Customized auditing.

What does auditing serve to accomplish?

The goal of an audit is to determine if the financial report's information, taken as a whole, accurately depicts the organization's financial situation as of a particular date. For instance, is the balance sheet accurately recording the organization's assets and liabilities?

Therefore since the goal of such a tailored audit, aside from cost and time savings, so, it is to present an objective overall picture of your supplier's organization in all pertinent disciplines, allowing you to better target risk areas and allocate control resources where they are most needed.

Learn more about Customized auditing from

https://brainly.com/question/7890421
#SPJ1

See full question below

The security administrator for Corp.com. You are explaining to your CIO the value of credentialed scanning over non-credentialed scanning. In credentialed scanning, policy compliance plugins give you which advantage?

More accurate results

Safer scanning

Customized auditing

Active scanning

TRUE/FALSE 75POINTS
1 Newspapers are forms of digital media
True
False

2 Moore's Law says that every two years the speed of computers doubles.
True
False

3 Web 2.0 is place where digital media is not just received but both created and shared.
True
False
4 click farms are interactive games for web2.0 users
true
false

5 Careers in digital media have drastically declined in recent years.
True
False

Answers

Newspapers are forms of digital media is a false statement.

Moore's Law says that every two years the speed of computers doubles is a true statementWeb 2.0 is place where digital media is not just received but both created and shared is a true statement.The click farms are interactive games for web2.0 users is a false statement.Careers in digital media have drastically declined in recent years is a false statement.

What are the types of newspaper media?

A newspaper is known to be a kind of a Print Media.  Note that it is said to be the oldest media forms and they are known to be newspapers, magazines, journals and others.

Also, Moore's Law is said to be one that states that the amount of transistors on a processor chip will become a double portion every 18 month

Therefore,   Newspapers are forms of digital media is a false statement.

Moore's Law says that every two years the speed of computers doubles is a true statementWeb 2.0 is place where digital media is not just received but both created and shared is a true statement.The click farms are interactive games for web2.0 users is a false statement.Careers in digital media have drastically declined in recent years is a false statement.

Learn more about Newspapers from

https://brainly.com/question/26027924

#SPJ1

Sergio needs to tell his team about some negative feedback from a client. The team has been
working hard on this project, so the feedback may upset them. Which of the following explains
the best way for Sergio to communicate this information?

A) Hold an in person meeting so that he can gauge the team's body language to assess their
reaction

B) Send a memorandum so everyone will have the feedback in writing

C) Hold a video conference so everyone can see and hear about the client's concern without the group witnessing each other's reactions

D) Send an email so everyone will have time to think about the feedback before the next team meeting

Answers

Answer:

A

Explanation:

I feel that if everyone is with eachother, there may be a better hope to improve the next time

PLEASE HURRY!!!
Look at the image below!

PLEASE HURRY!!!Look at the image below!

Answers

The answer is hello dad

In order to estimate the cost of painting a house, a painter needs to know the surface area of the exterior. Develop an algorithm for computing that value. Your inputs are the width, length, and height of the house, the number of windows and doors, and their dimensions. (Assume the windows and doors have a uniform size.)

Answers

Algorithms are used as prototypes for a complete program.

The algorithm to print the surface area of the exterior is as follows:

1. Start

2. Input the number of windows (n1)

3. Input the number of doors (n2)

4. Input the Length and Width of the windows (L1, W1)

5. Input the Length and Width of the doors (L2, W2)

6. Input Length, Width and Height of the Building

7. Calculate the area of the all windows: Area1 = n1 * L1 * W1

8. Calculate the area of the all doors: Area2 = n2 * L2 * W2

9. Calculate the surface area of the building: Area = 2 * (Length * Width + Length * Height + Width * Height)

10. Calculate the surface area of the exterior. Exterior = Area - Area1 - Area2

11. Display the surface area that can be painted; Exterior

12. Stop

The algorithm is self-explanatory, as all 12 lines of the algorithm are in plain English language.

The surface area of the exterior is calculated by subtracting the areas of all doors and windows from the surface area of the building.

Read more about algorithms at:

https://brainly.com/question/24568182

7.9.6 Enable Device LogsYou are the IT security administrator for a small corporate network. You need to enable logging on the switch in the networking closet.In this lab, your task is to perform the following:• Enable Logging and the Syslog Aggregator• Configure RAM Memory Logging as follows:o Emergency, Alert, and Critical: Enableo Error, Warning, Notice, Informational, and Debug: Disable• Configure Flash Memory Logging as follows:o Emergency and Alert: Enableo Critical, Error, Warning, Notice, Informational, and Debug: DisableTask SummaryEnable logging and the Syslog aggregatorSet RAM memory logging to CriticalSet Flash memory logging to AlertsExplanationIn this lab, you perform the following:• Enable Logging and the Syslog aggregator• Configure RAM memory logging as follows:o Emergency, Alert, and Critical: Enableo Error, Warning, Notice, Informational, and Debug: Disable• Configure Flash memory logging as follows:o Emergency and Alert: Enableo Critical, Error, Warning, Notice, Informational, and Debug: DisableComplete this lab as follows:1. From the left menu, expand the Administration.2. Expand System Log.3. Select Log Settings.4. Under Logging, select Enable.5. Under Syslog Aggregator, select Enable.6. Under RAM Memory Logging, enable and disable the appropriate settings.7. Under Flash Memory Logging, enable and disable the appropriate settings.8. Click Apply.

Answers

Since you are the IT security administrator for a small corporate network. The steps to to enable logging on the switch and carry out the task is given below.

What is the role of the security administrator in the above case?

It is important to enable logging on network devices such as switches to collect and store information about network activity and events. This can be useful for troubleshooting issues, detecting security breaches, and performing forensic analysis.

To enable logging on the switch in this scenario, you would need to follow the steps provided in the lab instructions:

From the left menu, expand the Administration menu.Expand the System Log submenu.Select the Log Settings option.Under the Logging section, select the Enable option.Under the Syslog Aggregator section, select the Enable option.Under the RAM Memory Logging section, enable the Emergency, Alert, and Critical options, and disable the Error, Warning, Notice, Informational, and Debug options.Under the Flash Memory Logging section, enable the Emergency and Alert options, and disable the Critical, Error, Warning, Notice, Informational, and Debug options.Click the Apply button to save the changes.

Therefore, These steps will enable logging and the Syslog aggregator on the switch, and configure the RAM and flash memory logging to capture only certain types of events. This can help to reduce the amount of log data that is generated and stored, while still capturing important information.

Learn more about security administrator from

https://brainly.com/question/29645753

#SPJ1

write a statement that assigns middleinitial with the character t

Answers

MiddleInitial is a variable that has been assigned a character value such as 'T' or 't' . It can be used to store the middle initial of a person's name.

middleinitial = 't'; .

MiddleInitial is a variable that can be used to store the middle initial of a person's name. It is typically a character variable and can be used in various ways depending on the specific application.

For example, middleInitial might be used as a part of a larger data structure that stores personal information, such as a person's name, address, and phone number. This information can then be used in a program to generate a mailing label or to search for a specific person in a database.

Another way middleInitial might be used is in a program that takes user input and performs validation checks on it. For example, a program that prompts a user to enter their name might check that the middle initial entered is a single uppercase letter before proceeding.

It's important to note that the exact behavior of middleInitial in a program will depend on how it is used and where it is used. And also it's value is not predetermined, it's value will be assigned by the user or the programmer.

Learn more about middleInitial here:

https://brainly.com/question/14283266

#SPJ4

The assignment is to get an integer from input, and output that integer squared, ending with newline. (Note: This assignment is configured to have students programming directly in the zyBook. Instructors may instead require students to upload a file). Below is a program that's been nearly completed for you.

Click "Run program". The output is wrong. Sometimes a program lacking input will produce wrong output (as in this case), or no output. Remember to always pre-enter needed input.
Type 2 in the input box, then click "Run program", and note the output is 4.
Type 3 in the input box instead, run, and note the output is 6.
When students are done developing their program, they can submit the program for automated grading.

Click the "Submit mode" tab
Click "Submit for grading".
The first test case failed (as did all test cases, but focus on the first test case first). The highlighted arrow symbol means an ending newline was expected but is missing from your program's output.
Matching output exactly, even whitespace, is often required. Change the program to output an ending newline.

Click on "Develop mode", and change the output statement to output a newline: print(userNumSquared). Type 2 in the input box and run.
Click on "Submit mode", click "Submit for grading", and observe that now the first test case passes and 1 point was earned.
The last two test cases failed, due to a bug, yielding only 1 of 3 possible points. Fix that bug.

Click on "Develop mode", change the program to use * rather than +, and try running with input 2 (output is 4) and 3 (output is now 9, not 6 as before).
Click on "Submit mode" again, and click "Submit for grading". Observe that all test cases are passed, and you've earned 3 of 3 points.

The assignment is to get an integer from input, and output that integer squared, ending with newline.

Answers

The issue in the code is that you're adding instead of multiplying the number by itself.

You can fix it by changing the second line to one of the two:

userNumSquared = userNum * userNum

or

userNumSquared = userNum ** 2

Ann, a user, reports that she is no longer able to access any network resources. Upon further investigation, a technician notices that her PC is receiving an IP address that is not part of the DHCP scope. Which of the following explains the type of address being assigned?

A. Unicast address
​B. IPV6
​C. DHCP6
D. APIPA

Answers

Answer: APIPA

Explanation:

Automatic Private IP Addressing (APIPA) is a Windows based operating systems feature that allows a computer to assign itself automatically to an IP address even though there is DHCP server to perform the function.

From the information that has been provided in the question, we can see that the type of address that is used is APIPA.

Do you think that it is acceptable to base employment decisions solely on historical data?
No, the historical data may be biased against some candidates.
Yes, because knowing what worked before leads to choosing qualified candidates.
No, previous decisions should not be considered.
Yes, since the data can be used to create a decision-making algorithm.

Answers

Answer:

no

Explanation:

No, the historical data may be biased against some candidates.

The employment decisions should base solely on historical data because the data can be used to create a decision-making algorithm.

What is historical data?

A historical data is the data that is collected based on past events and circumstances concerning an individual during an employment or about an organisation.

Employment decisions by human resource officers should be based solely on the historical data of their employees because it will give them insight on final decision to make.

Learn more about data here:

https://brainly.com/question/26711803

#SPJ2

Classify correctly linear and nonlinear multimedia.
movie at cinema
web page
video game
live video feed
e-book with links
instructional video
slideshow
Linear Multimedia
Nonlinear Multimedia

Answers

Answer:

movie at cinema - Linear Multimedia

web page - Nonlinear Multimedia

video game - Nonlinear Multimedia

live video feed - Nonlinear Multimedia

e-book with links - Nonlinear Multimedia

instructional video - Linear Multimedia

slideshow - Linear Multimedia  

Explanation:

The linear multimedia will go from the start all the way through to the finish without variation.

The Nonlinear Multimedia is the opposite; it doesn't follow that one-way structure and instead allows free movement around all aspects of the multimedia in any order.

movie at cinema - Linear Multimedia

web page - Nonlinear Multimedia

video game - Nonlinear Multimedia

live video feed - Nonlinear Multimedia

e-book with links - Nonlinear Multimedia

instructional video - Linear Multimedia

slideshow - Linear Multimedia

Which of these is a Microsoft certification for system engineers

Answers

Answer: B. MCSE

Explanation:

Microsoft offers various courses and certifications for different careers in the IT industry. One such career is system engineering where the MCSE which stands for Microsoft Certified Solutions Expert is offered.

This certification proves that one is proficient with technologies such as server infrastructure, data platforms and business intelligence. Prospective careers apart from sound engineering include Network management and Database Analysis.

Which statement allows us to return values from functions?

Answers

Answer:

the return statement

Explanation:

The return statement

Figure out what this says:

?driew tib a kool ti seoD

Answers

Answer:

Does it look a bit weird?

what are demographics

Answers

Answer:

What Is Demographics? Demographic analysis is the study of a population based on factors such as age, race, and sex. Demographic data refers to socio-economic information expressed statistically including employment, education, income, marriage rates, birth and death rates and more

Explanation:

Yea

Answer:

The Characteristics of a population of people

Explanation:

learned it in class

Before the new website launch, development team does not want users to access the site while it is still under construction. How can this requirement be met?

Answers

This requirement can be met by drafting a short text that says that the website is under construction. You could also specify the exact date when the site will be restored.

How to meet the requirement

If you are still working on a website and do not want users to access the site, you should leave a message on the site that says that the website is still under construction.

The link to the website should directly lead to this message. In this space, you should also specify the date and time when the site will be restored.

Learn more about websites here:

https://brainly.com/question/31732575

#SPJ1

list four reasons why technology is important​

Answers

Answer:

its help comunicate with other out of reach in person you can learn from it esiear for students to find information on technolongy than in a textbook it has designed buildings and ect.

Explanation:

it is a big part of my life

How does a Cloud-first strategy approach a client's migration to the Cloud?

Answers

Answer:

by focusing on a single discipline based on the client's greatest area need.

Which roles Primary responsibility is the handling of the physical media

Answers

The physical layer is in charge of transmitting computer bits from one device to another across the network.

What is physical media?

Physical media are the physical materials used to store or transmit data in data communications.

These physical media are typically physical objects made of metals or glass. They have physical properties such as weight and color and can be touched and felt.

Unguided Media or Unbounded Transmission Media are other terms for wireless communication. There is no physical medium required for the transmission of electromagnetic signals in this mode.

The physical layer is in charge of sending computer bits across the network from one device to another.

Thus, this is the role that Primary responsibility is the handling of the physical media.

For more details regarding physical media, visit:

https://brainly.com/question/5045828

#SPJ1

Translate 0xabcdef12 into decimal

Answers

The transformation of the hexadecimal abcdef12 in a decimal is of 2,882,400,018.

How a conversion from hexadecimal to decimal is made?

Considering the final digit as 0, and incrementing in a counter i, the conversion is given by the sum of the ith digit multiplied by ith power of 16.

In hexadecimal base, we have to consider that: a = 10, b = 11, c = 12, d = 13, e = 14, f = 15.

Hence, the decimal equivalent of 0xabcdef12 is given by:

\((abcde f12)_{16} = 2 \times 16^0 + 1 \times 16^1 + 15 \times 16^2 + 14 \times 16^3 + 13 \times 16^4 + 12 \times 16^5 + 11 \times 16^6 + 10 \times 16^7 = 2,882,400,018\)

More can be learned about the transformation of hexadecimal to decimal at https://brainly.com/question/17946394

(0)
Write a grading program for an instructor whose course has the following policies:
* Two quizzes, each graded on the basis of 10 points, are given.
* One midterm exam and one final exam, each graded on the basis of 100 points,
are given.
* The final exam counts for 40 percent of the grade, the midterm counts for 35 percent, and the two quizzes together count for a total of 25 percent. (Do not forget to normalize the quiz scores. They should be converted to percentages before they are averaged in.)
Any grade of 90 percent or more is an A, any grade between 80 and 89 percent is a B, any grade between 70 and 79 percent is a C, any grade between 60 and 69 percent is a D, and any grade below 60 percent is an F.
The program should read in the student's scores and display the student's record, which consists of two quiz scores, two exam scores, the student's total score for the entire course, and the final letter grade. The total score is a number in the range 0-100, which represents the weighted average of the student's work.
Create a method for input that both prompts for input and checks to make sure the grades are in an appropriate range. Use a while loop to get another input value until the grade is in range.

Answers

The grading program for an instructor whose course has following policies are given below : import java.util.Scanner;

Programming :

import java.util.Scanner;

public class Student{

  Scanner in = new Scanner(System.in);

   String name;

   double quiz1, quiz2, midTerm, finalTerm, grade;

   void readInput(){

       System.out.print("Enter student's name: ");

       name = in.nextLine();

       while(true){

           System.out.print("Enter the grades in quiz 1: ");

           quiz1 = in.nextDouble();

           if(quiz1 < 0 || quiz1 > 10) System.out.print("Invalid grade.");

           else break;

       }

       while(true){

          System.out.print("Enter the grades in quiz 2: ");

           quiz2 = in.nextDouble();

           if(quiz1 < 0 || quiz1 > 10) System.out.print("Invalid grade.");

           else break;

       }

       while(true){

           System.out.print("Enter the grades in mid term: ");

           midTerm = in.nextDouble();

           if(midTerm < 0 || midTerm > 100) System.out.print("Invalid grade.");

           else break;

       }

       while(true){

           System.out.print("Enter the grades in final term: ");

           finalTerm = in.nextDouble();

           if(finalTerm < 0 || finalTerm > 100) System.out.print("Invalid grade.");

           else break;

       }

   }

   void calculateGrade(){

       grade = (quiz1 + quiz2) * 1.25 + midTerm * 0.25 + finalTerm * 0.5;

   }

   void writeOutput(){

       System.out.println("\n\nStudent " + name + "\n" + "had these scores");

       System.out.println("First quiz " + quiz1 + "\nSecond quiz " + quiz2);

       System.out.println("Midterm exam " + midTerm + "\nFinal exam " + finalTerm);

       System.out.print("the total score is " + grade + "\nthe letter grade is ");

       if(grade >= 90) System.out.println("\"A\"");

       else if(grade >= 80) System.out.println("\"B\"");

       else if(grade >= 70) System.out.println("\"C\"");

       else if(grade >= 60) System.out.println("\"D\"");

       else System.out.println("\"F\"");

   }

}

// StudentDemo.java

import java.util.Scanner;

public class StudentDemo{

   public static void main(String[] args){

       Scanner scan = new Scanner(System.in);

       Student person = new Student();// one Student

       int numberOfStudents, i;

       System.out.print("Enter number of Students:");

       numberOfStudents = scan.nextInt();

       for(i = 0; i < numberOfStudents; i++){

           person.readInput();

           person.calculateGrade();

           person.writeOutput();

       }

   }

}

Complete Program to copy :

<terminated> Student Demo [Java Application] /opt/eclipse/jre/bin/java (30-Jul-2014 9:54:37 am)

Enter number of Students:1

Enter student's name: John J Smith

Enter the grades in quiz 1: 7

Enter the grades in quiz 2: 8 Enter the grades in mid term: 90

Enter the grades in final term: 80

Student John J Smith

had these scores

First quiz 7.0

Second quiz 8.0

Midterm exam 90.0

Final exam 80.0

the total score is 81.25

the letter grade is "B"

What does the grading system aim to accomplish?

A grading system's primary purpose is to evaluate a student's academic performance. This method, which is used in schools all over the world, is thought to be the best way to test a child's grasping and reciprocating skills.

Incomplete question :

Write a grading program for an instructor whose course has the following policies:

* Two quizzes, each graded on the basis of 10 points, are given.

* One midterm exam and one final exam, each graded on the basis of 100 points, are given.

* The final exam counts for 50 percent of the grade, the midterm counts for 25 percent, and the two quizzes together count for a total of 25 percent. (Do not forget to normalize the quiz scores. They should be converted to percentages before they are averaged in.)

Any grade of 90 percent or more is an A, any grade between 80 and 89 percent is a B, any grade between 70 and 79 percent is a C, any grade between 60 and 69 percent is a D, and any grade below 60 percent is an F.

The program should read in the student's scores and display the student's record, which consists of two quiz scores, two exam scores, the student's total score for the entire course, and the final letter grade. The total score is a number in the range 0-100, which represents the weighted average of the student's work.

Create a method for input that both prompts for input and checks to make sure the grades are in an appropriate range. Use a while loop to get another input value until the grade is in range.

import java.util.Scanner;

public class StudentDemo

{

public static void main(String[] args)

{

Scanner scan = new Scanner(System.in);

Student person = new Student ();// one Student

int number Of Students, i;

System.out.println("Enter number of Students:");

number Of Students = scan.nextInt( );

for(i = 0; i < number Of Students; i++)

{

person.read Input();

person.calculateGrade();

person.writeOutput();

}

}

}

/* sample output with numbers that are accurately computed:

Student John J Smith

had these scores

First quiz 7

Second quiz 8

Midterm exam 90

Final exam 80

the total score is 81.25

the letter grade is "B" */

Learn more about Grading program :

brainly.com/question/29497404

#SPJ4

.
Where should you select to create a bibliography citation source?
A. At the end of the text you want to cite
B. At the top of the page
C. At the beginning of the text you want to cite
D. At the bottom of the page

Answers

A) at the end of the text you want to cite

Discuss the decidability/undecidability of the following problem.
Given Turing Machine , state of and string ∈Σ∗, will input ever enter state ?
Formally, is there an such that (,⊢,0)→*(,,)?

Answers

Note that in the caseof the problem described, there is no algorithm that can determine with certainty whether   a given Turing machine, state, and input string will ever enter a specific state.

How is this so?

The problem of determining whether a given Turing machine, state, and string will ever enter a specific state is undecidable.

Alan Turing's   halting problem proves that thereis no algorithm that can always provide a correct answer for all inputs.

Due to the complex and unpredictable   behavior of Turing machines, it is impossible todetermine if a state will be reached in a general case.

Learn more about Turning Machine at:

https://brainly.com/question/31771123

#SPJ1

Other Questions
Which of these is true of the Roman road system?1. Augustus had all Roman roads paved with marble.2. Improving the roads helped the Roman Empire to grow.3. The road system provided easy access for enemies to invade Rome.4. Roman roads were built only during times of peace. two major forms of distraction associated with crash scenes are WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? Elizabeth Wong has strong problem-solving skills and loves to work with people. After becoming a Certified Human Resources Professional (CHRP) and working for several companies, she opened her own business, HR Solutions. She completed the following transactions during May 2020: May 1 Invested $73,000 in cash and office equipment that had a fair value of $46,000 in the business. 1 Prepaid $13,800 cash for three months' rent for an office. 2 Made credit purchases of office equipment for $23,000 and office supplies for $4,600. 6 Completed a report on hiring solutions for a client and collected $7,800 cash. 9 Completed a $15,800 project implementing a training program for a client, who will pay within 30 days. 10 Paid half of the account payable created on May 2. 19 Paid $7,300 cash for the annual premium on an insurance policy. 22 Received $12,600 as partial payment for the work completed on May 9. 25 Developed a performance review process for another client for $5,080 on credit. 25 Paid wages for May totalling $33, see. 31 Withdrew $4,800 cash from the business to take a trip to Paris in June. 31 Purchased $1,508 of additional office supplies on credit. 31 Paid $1,380 for the month's utility bill.Required: 1. Prepare journal entries to record the transactions. what characteristics do bureaucracies share describe at least 3 differences between waves, currents, and tides. Concepcion is typically very shy and hates to take risks. A researcher who takes the _____ approach to personality might argue that Concepcion is shy because she is often in circumstances that call for her to be outgoing. what is the value of X What is the greatest possible quotient of any two distinct members of the set $\left\{\frac{2}{5}, \frac{1}{2},5,10\right\}$? Specifically, we wish to maximize $\frac{x}{y}$, where $x$ and $y$ are chosen from the previous set. What are the factors of x Y? Why doesn't the earth block out the light between the sun and the moon during a normal month A company forecast to have negative economic value added (EVA) forever, will be trading at EV/Capital ratio that is smaller than one. (All else equal.) True False Next Previous 4 pts Question 11 6 pts Sprung Verlag's is currently trading at a PE ratio of 10 and has a return on equity (ROE) equal to 20% and net prot margin (NPM) equal to 10%. Given this information what are Sprung Verlag's PB and PS ratios? OPB-1 and PS-1 OPB-1 and PS-20 PB-2 and PS-1 PB-2 and PS-2 it is impossible to determine PB and PS from the information provided 12. Cmo puedes responder? Dnde te quedaste?O Me qued en un hotelO Me quedr en un hotelO Me querrd en un hotel Based on federalist papers number 70, how would Neustadt judge the power of Donald Trump? Support your answer with evidence from federalist papers number 70. If you test a sample and find out that one million cells/ml of Escherichia coli has an OD reading of 0.23, would you expect the same OD, a higher or a lower OD if you had one million fungal cells? Explain your answer A bank tellers hourly wage will increase from $24 to $27.60. What percent increase does this represent? can someone help me ? Which of the following is not true about potential energy?Select one:a.b.C.d.Potential energy is stored energy.Potential energy is related to position.Potential energy is a scalar quantity.Potential energy has direction. Can someone please explain how to do this? thank you! Marina collects and records data in an Excel spreadsheet. She uses the data to produce a line graph. Marina wants to change the graph so the minimum distance on the y-axis is 0. What should be done to make this change?A. Adjust the Minimum option to Fixed and change to 0. B. Adjust the chart style to a 3-D chart so all the data will be displayed. C. Adjust the selection pane so that the full range of data is selected. D. Adjust the intervals between tick marks to -10 in the Axis Options box.