Lawmakers discuss methods of preventing pollutants that could directly start
a positive feedback loop in the area shown in the picture.
Which
of these
actions
should
they
take?
Total Ozone (Dobson units)
A. Ban the use of
chlorofluorocarbons
in rigeration
systems
B. Increase funding for coal technology
C. Lower allowed concentrations of particulate matter released from
factory smokestacks.
D. Increase the number of jets flying in the upper troposphere.

Lawmakers Discuss Methods Of Preventing Pollutants That Could Directly Starta Positive Feedback Loop

Answers

Answer 1

Answer:

A.

Explanation:

A P E X

Answer 2

Lawmakers discuss methods of preventing pollutants that could directly start a positive feedback loop in the area shown in the picture, and this happens due to the ban on the use of chlorofluorocarbons in refrigeration systems that is in Option A.

What are the negative impacts of chlorofluorocarbons on the ecosystem?

The ozone layer is an important component of the atmosphere that protects life on Earth from harmful ultraviolet radiation from the sun, and one of the major threats to the ozone layer is the release of man-made chemicals such as CFCs, which can react with ozone and deplete it, so if the ozone layer is depleted, more ultraviolet radiation can reach the Earth's surface, causing skin cancer, cataracts, and crop damage.

Hence, this happens due to the ban on the use of chlorofluorocarbons in refrigeration systems that is in Option A.

Learn more about the negative impacts of chlorofluorocarbons here.

https://brainly.com/question/29051811

#SPJ7


Related Questions

4. on the basis of fragment size, how can the difference between the wild-type sequence and the homozygous mutant sequence be recognized

Answers

The difference between the wild-type sequence and the homozygous mutant sequence can be recognized based on fragment size by using a technique called gel electrophoresis. Gel electrophoresis is a commonly used method to separate DNA fragments based on their size.

1. DNA Extraction: First, DNA is extracted from the wild-type sample and the homozygous mutant sample using standard laboratory techniques.

2. DNA Digestion: The extracted DNA is then treated with a restriction enzyme that cuts the DNA at specific recognition sites. This step generates DNA fragments of different sizes.

3. Gel Preparation: A gel matrix, typically made of agarose or polyacrylamide, is prepared. The gel is poured into a gel tray or a glass plate with wells where the DNA samples will be loaded.

4. Loading the Samples: The digested DNA samples from the wild-type and homozygous mutant sequences are loaded into separate wells on the gel. In addition, a DNA ladder or size marker containing fragments of known sizes is also loaded onto the gel.

5. Electrophoresis: An electric current is applied to the gel, causing the negatively charged DNA fragments to migrate through the gel matrix towards the positive electrode. Smaller DNA fragments move more quickly through the gel than larger ones.

6. Visualization: After the electrophoresis process is completed, the DNA fragments are stained with a fluorescent dye or a DNA-specific dye, such as ethidium bromide. The dye binds to the DNA, allowing the fragments to be visualized under ultraviolet light.

7. Analysis: The DNA fragments in the gel are now separated based on size. By comparing the positions of the DNA fragments from the wild-type and homozygous mutant samples, any differences in fragment sizes can be identified.

Fragment sizes using gel electrophoresis, researchers can detect differences between the wild-type and homozygous mutant sequences and infer the presence of mutations or genetic variations in the DNA samples.

Learn more about homozygous

https://brainly.com/question/30622664

#SPJ4

the physical location where an organism lives is termed its? A. home boundary.
B. range.
C. habitat.
D. community.
E. ecosystem.

Answers

The physical location where an organism lives is termed its habitat. Here is the long answer:Habitat refers to the physical location or environment in which a species exists.

It is defined as a geographical region or an environment where a living organism resides, survives, and reproduces.In a habitat, the living and non-living factors play an essential role in the survival of organisms. Living factors like food, water, and shelter provide for the essential needs of the organism, while non-living factors such as temperature, soil type, and light influence the physical nature of the habitat.

Therefore, a habitat can be defined as the area where an organism or a group of organisms live, obtain food, water, and other necessities for their survival. Every species on Earth has its habitat where it lives, grows, and reproduces successfully.

To know more about habitat visit:-

https://brainly.com/question/28815163

#SPJ11

What is phagocytosis?
A. the process of red blood cells breaking down pathogens
B. the process of white blood cells breaking down pathogens
C. the self-death of pathogens
D. the shrinking of pathogens

Answers

Answer:

B. The process of white blood cells breaking down pathogens

Explanation:

Please correct me if I'm wrong

What is the defining characteristic of a
prokaryotic cell?
A. having a nucleus
B. not having a nucleus
C. not having DNA

Answers

Answer:

B

Explanation:

Prokaryotic cells lack a nucleus

What is a negative feedback?

Answers

a negative feedback occurs when some function of the output of a system, process, or mechanism is fed back in a manner that tends to reduce the fluctuations in the output, whether caused by changes in the input or by other disturbances.

hemotherapy affects the __________ of cancer cells. These drugs can produce nausea because they affect __________ cells, which divide __________.

Answers

Answer:

The FitnessGram PACER Test is a multistage aerobic capacity test that progressively gets more difficult as it continues.

The test is used to measure a student's aerobic capacity as part of the FitnessGram assessment. Students run back and forth as many times as they can, each lap signaled by a beep sound. The test get progressively faster as it continues until the student reaches their max lap score.

The PACER Test score is combined in the FitnessGram software with scores for muscular strength, endurance, flexibility and body composition to determine whether a student is in the Healthy Fitness Zone™ or the Needs Improvement Zone

Explanation:

The FitnessGram PACER Test is a multistage aerobic capacity test that progressively gets more difficult as it continues.

The test is used to measure a student's aerobic capacity as part of the FitnessGram assessment. Students run back and forth as many times as they can, each lap signaled by a beep sound. The test get progressively faster as it continues until the student reaches their max lap score.

The PACER Test score is combined in the FitnessGram software with scores for muscular strength, endurance, flexibility and body composition to determine whether a student is in the Healthy Fitness Zone™ or the Needs Improvement Zone

several pharmacological agents have been shown to lower the pressure of the filtrate inside the lumen of nephrons. what affect will this have?

Answers

When Increased Bowman’s capsule hydrostatic pressure will decrease GFR, while decreased Bowman’s capsule hydrostatic pressure will increase GFR.  Thus the correct answers are options (C, and D).

Hydrostatic pressure changes that affect the flow of blood to the glomerulus can be caused by a variety of variables, changing GFR. The glomerulus's hydrostatic pressure variations are what affect GFR the most. The amount of blood is one important bodily example.

Increased blood volume will raise blood pressure throughout the body because of Starling's law of the heart. The higher blood pressure and increased blood volume will enter the afferent arteriole and the glomerulus, increasing GFR. On the other hand, people who are dehydrated and have little blood volume will have a lower GFR.

GFR will also be impacted by pressure variations in the afferent and efferent arterioles that enter and exit the glomerulus itself.

Blood flow (and hydrostatic pressure) in the glomerulus will increase due to vasodilation in the afferent arteriole and vasoconstriction in the efferent arteriole, which will also increase GFR. In contrast, GFR will be reduced by vasoconstriction in the afferent arteriole and vasodilation in the efferent arteriole.

The glomerulus is pushed against by the hydrostatic pressure that is generated within the Bowman capsule space. GFR will decrease with increased Bowman's capsule hydrostatic pressure while increasing with decreased Bowman's capsule hydrostatic pressure.

A ureter obstruction that impairs urine flow and progressively results in fluid accumulation within the nephrons is an illustration of this. A blockage will raise the hydrostatic pressure in the Bowman's capsule, which will lower GFR.

The complete question is:

Several pharmacological agents have been shown to lower the pressure of the filtrate inside the lumen of nephrons. What effect will this have?  

a. hydrostatic pressure of fluid in the Bowman’s capsule increases, GFR increases  

b. the hydrostatic pressure of fluid in the Bowman’s capsule decreases, GFR decreases

c. hydrostatic pressure of fluid in the Bowman’s capsule increases, GFR decreases

d. the hydrostatic pressure of fluid in the Bowman’s capsule decreases, GFR increases

To learn more about GFR please click on the given link: https://brainly.com/question/28163756

#SPJ4


Select the best answer for the question.
13. How does the principle of faunal succession assist the technique
O A. It creates unconformities in the rock layers.
O B. It accounts for the tectonic movement throughout history.
O C. It prioritizes parts before the whole appearance of organisms.
O D. Fossils appear in the strata in a specific order based on age.

Answers

Fossils appear in the strata in a specific order based on age. The correct option is D

What is the principle of faunal succession?

Principle of faunal succession states that fossils appear in rock strata in a specific, predictable order based on the relative ages of the rock layers and the evolutionary relationships of the organisms represented by the fossils.

This principle allows geologists to use the relative ages of rocks and fossils to determine the relative age of other rocks and fossils in the same area and to establish a relative time scale for geologic events.

Therefore, By comparing the sequence of fossils in different rock strata, geologists can determine which strata are younger and which are older, and thus build a chronological framework for the Earth's history.

Learn more about  principle of faunal succession here: brainly.com/question/13674871

#SPJ1

a scientist grows cells in a dish, which cells are most likely to perform cell division

A. the cells at the edge of the group

B. the cells in the center of the group

C. the cells with the least DNA

D. the cells with the smallest surface areas

Answers

Answer:

all : 

Explanation:

Predator instincts is what causes it Amutation is basically the change in the gene, caused by alteration of single based units in the dna, or the genes or chromosomes were rearranged in the dna

An edible substance, like salt, does not pose any harm to you or the environment:
Explain why you Agree or Disagree?

Answers

Answer:

Its depends

Explanation:

But for salt it doesnt really pose any harm to the environment because salt is just a mineral/rock. Hope that helps

Why might the number of cases have decreased in 1953 and then increased in 1945?’polio vaccine

Answers

In 1953, polio cases decreased, while in 1945, they increased. The first polio vaccine, produced by Dr. Jonas Salk, was presented in 1955.

We may use history to learn how the polio vaccine affected cases. Polio was highly contagious and caused thousands of cases and outbreaks before vaccinations. The mid-1950s polio vaccine introduction changed the fight against polio.

Polio cases plummeted once Dr. Albert Sabin's 1960s oral polio vaccine (OPV) became widely available. Mass immunisation campaigns reduced disease spread and new infections.

While the polio vaccine has reduced polio incidence worldwide, some countries may still experience outbreaks due to low vaccination coverage, inadequate healthcare infrastructure, or difficulties reaching certain populations. However, polio immunisations have reduced the global disease burden.

Learn more about Polio, here:

https://brainly.com/question/22955098

#SPJ1

What goes first with organ ,epithelial tissue ,epithelial cell and organ system

Answers

Epithelial tissue lines the organs of the body, including the lungs, heart, and stomach.

Is epithelium an organ system?

Epithelium, endothelium, and mesothelium are three types of epithelial cell sheets that line your internal organs, and body space and form the outer layer of your skin. Epithelium generally lines alleyways that are open to the external environment, such as your respiratory area and digestive system.

Glandular epithelial tissue is also established as part of the glands, including hormone-manufacture organs like the liver, pancreas, and spleen. Epithelial tissues are widespread all around the body. They form the covering of all body surfaces.

So we can conclude that Simple epithelial tissues are normally classified by the shape of their cells.

Learn more about epithelial here: https://brainly.com/question/17301113

#SPJ1

Which analogy best describes the spinal cord?

1.A slip-and-slide that makes the nervous system fun

2.A highway for nerve messages to travel from the brain to the body and back

3.A big collection of bones that helps us stand up straight
1 p

Answers

number 3 is the correct answer

Answer this for 10 points ✌
what is mid brain?​

Answers

A relatively small region of the upper brainstem that connects the forebrain and hindbrain. It contains the tectum (and associated inferior and superior colliculi), tegmentum, and substantia nigra. Also called mesencephalon.

\( \\ \)



HELP ASAP PLEASEEEE, idk how to draw this, if anybody could show me QUESTION 1

HELP ASAP PLEASEEEE, idk how to draw this, if anybody could show me QUESTION 1

Answers

Answer:

I think this is the answer (not sure)

Explanation:

HELP ASAP PLEASEEEE, idk how to draw this, if anybody could show me QUESTION 1

CATCGATACCATTCGGCGCATACTTCG

Translate the dna. Sequence

Answers

Answer: The DNA sequence CATCGATACCATTCGGCGCATACTTCG translates to the mRNA sequence GUAGCUAUCCUAAGCCGCGUAUGAAGC

Explanation: To translate a DNA sequence into amino acids, we need to first transcribe it to mRNA. This is done by changing T (thymine) to U (uracil). So in this case, the DNA sequence

CATCGATACCATTCGGCGCATACTTCG

transcribes to the mRNA sequence

GUAGCUAUCCUAAGCCGCGUAUGAAGC.

The next step is to divide the mRNA sequence into codons. A codon is a sequence of three nucleotides that codes for one amino acid. In this case, the codons are:

GUU (Val) GCU (Ala) UAU (Tyr) CCU (Pro) AAU (Asn) GCG (Ala) UAU (Tyr) GAA (Glu)

The sequence ends with a stop codon, which does not code for an amino acid.

Using the genetic code, we can convert each codon to its corresponding amino acid. The resulting polypeptide sequence is:

Val-Ser-Ile-Leu-Ser-Ala-Val-Stop.

Therefore, the DNA sequence CATCGATACCATTCGGCGCATACTTCG translates to the polypeptide sequence Val-Ser-Ile-Leu-Ser-Ala-Val-Stop.

Hope this helps, and have a great day!

Will a paper airplane with longer wings fly farther than shorter wings?

Answers

Answer:

yes

Explanation:

because pwede nya liparin hagang 10meters

Answer:

no .the shorter wings fly farther than longer wings

Temperate conditions: Temperate conditions: Tend to be good for preservation of most materials because they are mild climates. Tend to destroy delicate materials because of fluctuating rain and relatively warm temperatures. Tend to be bad for preservation because of high atmospheric levels of oxygen. Tend to preserve organics well, but erode inorganic materials quickly.

Answers

Because of the fluctuating rainfall and generally warm temperatures, fragile goods have a tendency to be destroyed.

Fluctuating:

When something dies, living things: Stop consuming carbon-14, which enters the food chain through carbon dioxide. Which of the following animal remains is most frequently used by archaeologists to ascertain environmental conditions? Microscopic animals like amber at, insects, rodents, and even microscopic organisms!To uncertainly back and forth-shift Oil prices were fluctuating. The temperatures changed. 2: to fluctuate in waves or as if in waves On the choppy water, the boat shook. a transitive verb that means to produce a change.During the growing season of the crops, the farmers also experienced fluctuating  rain, which is defined as unpredictable and out-of-season rain. This was particularly true during flowering, when the rain could damage and shed pulse flowers and prevent pollination, which would negatively impact fruit setting and reduce yields.

Learn more about fluctuating here brainly.com/question/28133503

#SPJ4

QUESTION 10
Which three components are common to the circulatory systems of most living animals?
arteries, veins, capillaries
vessels, heart, circulating fluid
aorta, ventricles, atria
blood, heart, cavities

Answers

Answer:

B. VESSELS, HEART, CIRCULATING FLUID.

Explanation:

Blood is the circulating fluid. It is the connective tissue of liquid plasma and cells.

Heart is a muscular pump to move the blood and have it circulate throughout the body of living animals.

Blood vessels are arteries, capillaries and veins that deliver blood to all tissues.

The Circulatory System has two types. They are the open circulatory system and the close circulatory system.

An open circulatory system is one where the blood does not circulate inside blood vessels  but also flows into cavities that irrigate tissues.

A close circulatory system is one where the blood circulate only inside the blood vessels.

Click to let others know, how helpful is

Mark me brainliest

Answer:

B)vessels, heart, circulating fluid

Explanation:

Cellular respiration use sugar and _______ to make ATP,_________ and ______

Help

Answers

Oxygen, water and carbon dioxide

PLEASE HELP ME ILL DOUBLE THE POINTS. I"M BEING TIMED


Genetically modified (GM) plants have their DNA altered by artificial means. Golden rice is genetically modified to increase its nutritional value. Scientists added genes from daffodils and bacteria to the genes of the rice. This alteration in genes produced rice plants that are rich in vitamin A. Genetic modification is not just used in agriculture, but also in the production of medicine. Which statement represents a health concern regarding the use of medical GM plants?
A. The cost of growing GM plants is too high.
B. The GM plants will have an increase in nutrient content.
C. Patients may develop allergies to the medicine made from the GM plants.
D. The GM plant might not be able to grow in the areas where the need is highest.

Answers

The answer is C, if it is used for medical reasons, if it developed allergies it isn’t good for people.

Answer:

Sorry about this i need point and yes it is C

Explanation:

When two amino acids join together, the amine group of one binds to the acid group of another in a unique type of chemical bond. What is the name of this bond?.

Answers

Answer:

pipetide bond

Explanation:

two amino acids are always joined together by a pipetide bond

In fact, he thought that if a species changed enough, it might evolve into a new species.

Answers

Answer:

More context

Explanation:

Therefore, he called this type of selection natural selection. Darwin knew artificial selection could change domestic species over time. ... In fact, he thought that if a species changed enough, it might evolve into a new species.

reptile respiratory organs​

Answers

Answer:

Respiratory System. All reptiles breathe through their lungs. The reptile lung has a much greater surface area for the exchange of gases than the lungs of amphibians. Many reptiles' lungs have little sacs called alveoli, across which gas is exchanged.

Explanation:

The lizard breathes.

How does the character of mandy develop the theme of the story?

Answers

The character of Mandy develops the theme of the story by embodying the values and struggles that relate to the theme.

Through her actions, dialogue, and growth throughout the narrative, Mandy helps convey and explore the central message or idea of the story.

For example, if the theme of the story is resilience, Mandy's character may demonstrate resilience by facing challenges and overcoming them with determination and strength. Her experiences and interactions with other characters may highlight the importance of resilience in the face of adversity.

By portraying Mandy's character development in alignment with the theme, the story reinforces and reinforces the underlying message or lesson it aims to convey.

You can learn more about theme at

https://brainly.com/question/25336781

#SPJ11

which one of the following normally interrupts the positive feedback loop by which oxytocin causes milk ejection? a. a decrease in the number of target cells with oxytocin receptors b. an increase in the response to oxytocin c. a decrease in the number of oxytocin receptors on target cells d. an increase in the secretion of oxytocin e. removal of the stimulus

Answers

The positive feedback loop through which oxytocin increases milk ejection is typically broken by a rise in oxytocin output. Option d is Correct.

The infant sucking during breastfeeding causes the mother's pituitary gland to produce oxytocin. The smooth muscles around the milk-producing glands in the breast are then affected by oxytocin, which causes them to contract and secrete milk. This is a positive feedback loop because oxytocin release triggers milk ejection, which prompts more sucking, which triggers more oxytocin release, and so on.

The amount of milk that can be expelled at once is limited, and the repeated stimulation of oxytocin release might make the mother feel overstimulated and uncomfortable. Increased oxytocin secretion will be used to stop this. Option d is Correct.

Learn more about positive feedback visit: brainly.com/question/28271726

#SPJ4

When both glucose and lactose are present in the media in which E. coli is growing, which is the preferred carbon source? a Both Glucose and Lactose b Glucose c Lactose d Xylose

Answers

When both glucose and lactose are present in the media in which E. coli is growing, the preferred carbon source is glucose.

Thus, the correct option is B.

E. coli bаcteriа cаn breаk down lаctose, but it's not their fаvorite fuel. If glucose is аround, they would much rаther use thаt. Glucose requires fewer steps аnd less energy to breаk down thаn lаctose. However, if lаctose is the only sugаr аvаilаble, the E. coli will go right аheаd аnd use it аs аn energy source.

The preferred cаrbon source of E. coli is glucose. However, if glucose is unаvаilаble, E. coli hаs аn аlternаtive option: It cаn breаk down lаctose to produce glucose аnd gаlаctose.

For more information about glucose refers to the link: https://brainly.com/question/2396657

#SPJ11


That nature contributes to the supply of clean water is an
example of:
Choose one option:

Sustainability
Ecosystem services
Biomimicry
Industrial symbiosis

Answers

Ecosystem services is an example of how nature contributes to the supply of clean water. Ecosystem services are benefits that people obtain from ecosystems. They are distinguished into four categories: provisioning, regulating, cultural, and supporting services.

Ecosystem services include the provision of clean air and water, the pollination of crops, the mitigation of natural disasters, and the provision of recreational opportunities. Nature provides a variety of ecosystem services that are essential to human well-being. The supply of clean water is an example of ecosystem services. The water we drink comes from rivers, lakes, and underground aquifers that are replenished by rain and snowmelt.

These freshwater ecosystems not only provide us with water but also with food, fiber, and recreation opportunities. That nature contributes to the supply of clean water is an example of ecosystem services. Ecosystem services are benefits that people obtain from ecosystems.

The supply of clean water is one such service provided by nature, and it is essential for human well-being. The water we drink comes from rivers, lakes, and underground aquifers that are replenished by rain and snowmelt. These freshwater ecosystems not only provide us with water but also with food, fiber, and recreation opportunities.

To know more about Ecosystem, refer

https://brainly.com/question/842527

#SPJ11

duchenne muscular dystrophy (dmd) is a rare, x-linked recessive trait that causes muscular weakness, deterioration of muscle tissue, and loss of coordination. the allele for dmd is represented by xd and the normal allele is represented by xd. neither parent has dmd, but both of their sons express the trait. what are the most likely genotypes of the father's parents (ie. the son's paternal grandparents)? question 12 options: xdxd and xdy xdxd and xdy xdxd and xdy xdxd and xdy

Answers

The most likely genotypes of the father's parents (ie. the son's paternal grandparents) are XdXd and XDy.

Duchenne muscular dystrophy (DMD) is a rare, X-linked recessive trait that causes muscular weakness, deterioration of muscle tissue, and loss of coordination. The allele for DMD is represented by Xd and the normal allele is represented by XD. Neither parent has DMD, but both of their sons express the trait. The most likely genotypes of the father's parents (ie. the son's paternal grandparents) are XdXd and XDy.

Duchenne muscular dystrophy is a rare, genetic disorder characterized by progressive muscle weakness and degeneration. It affects mostly boys and typically becomes noticeable in early childhood. Children with Duchenne muscular dystrophy may have difficulty walking, running, and jumping.

They may also have difficulty climbing stairs and rising from a lying or sitting position. The disorder mainly affects skeletal muscles, which are used for movement but can also affect the heart and other organs.

DMD is an X-linked recessive disorder that is only expressed in males. As a result, only the mother can pass the DMD allele on to her sons. Neither parent has DMD, but both of their sons express the trait. Because of this, both parents must be carriers of the DMD allele, which means that they have one normal X chromosome and one DMD X chromosome.

You can learn more about genotypes at: brainly.com/question/30784786

#SPJ11

Media consumption is the:

A. Number of meals a person eats while using media.
B. Amount of money someone spends on networking devices.
C. Amounts of media a person uses on a regular basis.
D.number of media devices that are for sale online.

Answers

Answer:

C.

Explanation:

Media consumption is defined as the sum of information and entertainment media taken in by an individual or group.

Other Questions
helpppppppppppppp !!!!!!!!!!!! a. What did the Snow and the Frost do to the garden? (The Selfish Giant) b. What is the relationship between the portrait painter and its subject? (The Oval Portrait) c. Who is the speaker in the poem? (Corona Says) d. To which two things does the speaker compare his love in the first stanza? (A Red, Red Rose) What is the importance of the oral tradition? (Sharing Tradition) Gray whales (Eschrichtius robustus) gather each winter near Baja California to give birth. How might such behavior make it easier for ecologists to estimate birth and death rates for the species? Evaluate (35 = x)2 when x = 7O A. 3O B. 7O c. 5O D. 26I will give brainiest points conflicts are inevitable inside supply chains. which insight works best as a guideline that could be used to resolve these conflicts? Can someone help me please Ill mark you as a brainliest. What will print out when the following code executes? int[] nums = {1, 2, 3, 4, 5, 6}; int count = 0; while (nums[count] % 2 != 0) { nums[count+1] ++; count ++; } System.out.println(count); What explanation is given to the animals when the pigs move into the farmhouse? Solve these 2 equations (picture attached.)1. g(x)=1/5x2. g(x)=-1/5xNo proof is needed. Up high in the belfry, the birds erupted into a disruptive __________, ruining the recital; everyone who had come to hear the singers left quite __________.Possible Answers:cacophony . . . disgruntledmelody . . . haranguedharbinger . . . perturbedsong . . . stultifiedtremolo . . . ennobled There are two methods that could be used to complete an inspection: method A has a mean time of 32 minutes and a standard deviation of 2 minutes, while method B has a mean time of 36 minutes and a standard deviation of 1.0 minutes. If the completion times are normally distributed, which method would be preferred if the inspection must be completed in 38 minutes? Multiple Choice O Method A O Method B O Neither method would be preferred over the other. What are the 4 A's to solving conflict ? Read each of the characteristics below. Identify whether it describes colostrum or breast milk.- Helps prevent gastroenteritis- Higher in calcium- Higher in protein- Thin and watery- Provides a wide, systemic immunity to the newborn- Higher in fat- Higher in immunoglobulins- Higher in lactose Eric wants to perform an investigation on red blood cells....... 3. How did Peter the Great change the orthodox Church? A hospital has a total of ten knee surgeries and would like to schedule four of them to perform in a single day. how many ways can you schedule four knee surgeries out of a total of ten? Email communication is characterized by:___________. i. low control. ii. little coordination. iii. richness. iv. high cost. v. constraints. how did the mauryan empire promote cultural diffusion A square patio has a perimeter of (16x + 12) feet. What is the length of the patio? the pairs of polygons below are similar. give the scale factor of figure a to figurea 10:18:15 B 6:4:7.2