One hundred milliliters of water has a mass of 100 grams. what would be the mass of 50 milliliters of water?

Answers

Answer 1

Answer:

50 gs

Explanation:

because half of 100 gs is 50. your welcome!


Related Questions

What type of goal typically takes a couple of years or longer to complete?
A. An intermediate goal
B. An instant goal
C. A short-term goal
D. A long-term goal​

Answers

This would be a long term goal. Please give brainliest I need four more

A student placed one hundred dominoes upright in a row. He knocked over the first domino and the rest all fell over; one after another. What made the domino at the end of the row move?.

Answers

Answer:

newtons first law ; an object will stay at rest until a force is added onto it. Since the student knocked over the first domino that force the student added continues on until the row ends

Explanation:

Answer:

heat and energy

Explanation:

Still stuck? Get 1-on-1 help from an expert tutor now.

Select the correct answer. How does a proper warm up affect blood flow?
A. Blood flow increases.
B. Blood flow decreases.
C. Blood flow increases and then decreases.
D. Blood flow decreases and then increases.
<3

Answers

Answer:

a. blood flow increases

How does Wiesel feel about the power of memory? Highlight and label any rhetorical devices Wiesel uses to stress his point.

Passage: “Home, Despair, and Memory” By Elie Wiesel

Answers

Elie Wiesel is a Holocaust survivor, human rights advocate and writer, he wrote several books, one of the most famous one is Night, where he talks about his experience during the Holocaust and the impact it had on him and the power of memory in it.

In Night, Wiesel express his belief that the power of memory is essential to preserving the past and passing on the lessons of history. He uses various rhetorical devices to stress his point, including imagery, metaphor, and repetition.

For example, Wiesel repeatedly emphasizes the importance of bearing witness to the Holocaust, saying that "To forget would be not only dangerous but offensive; to forget the dead would be akin to killing them a second time" He uses imagery to describe the horrors he witnessed, such as describing the smell of burning flesh and ashes, this serve as a reminder of what happen.

He also uses metaphor to describe the impact of the Holocaust on his life, comparing it to a "golden chain" that links him to the past, and to the victims of the Holocaust.

Finally, Wiesel uses repetition to drive home the importance of remembering the Holocaust, repeatedly emphasizing that "For the survivor who chooses to testify, it is clear: his duty is to bear witness for the dead and for the living." This repetition serves to reinforce the importance of remembering the past in order to ensure that such atrocities will never happen again.

Why were the Hollywood Ten blacklisted?

because they made movies about controversial subjects
because they were writers, directors, and producers
because they were suspected to have communist ties
because they could not be forced to name radicals they knew

Answers

Answer:

because they were suspected to have communist ties

Explanation:

This was during the years of the cold war and the second red scare where many people were being suspect of having communist ties.

Answer:

Because they were suspected to have communist ties.

Explanation:

Gradpoint

(root 8)^a = 4^b/3
If a and b are positive numbers in the equation
above, then what is the value of a/b ?

A. 4/9
B. 2/3
C. 3/2
D. 9/4

Answers

Answer:

4/9

Explanation:

√8^a=4^b/3.

You can rewrite √8^a as 8^a/2.

So then that would be, 8^a/2=4^b/3.

If both sides have the same base, we could then make the fractional exponents equal to each other. Since 2^3=8 and 2^2=4, we can make that possible.

2^3(a/2)=2^2(b/3).

2^3a/2=2^2b/3.

 So now 3a/2=2b/3.

Then we isolate the a, by multiplying 2/3 on both sides and are left with:

a=2/3*2/3*b

a=4/9*b

Then you divide both sides by b to get:

a/b=4/9.

Question


In a recent poll, 13% of all respondents said that they were afraid of heights. Suppose

this percentage is true for all Americans. Assume responses from different individuals are

independent.

What is the probability of having NONE of the 3

randomly selected Americans say that they are afraid of

heights? Find P(3 people NOT afraid of heights).

Answers

A) The probability of 3 randomly selected Americans saying they are afraid of heights is 0.21%.

B) The probability of having none of the 3 randomly selected Americans say they are afraid of heights is 65.85%.

C) The probability of having at least 1 of the 3 randomly selected Americans say they are afraid of heights is 9.83%.

Given that in a recent poll, 13% of all respondents said that they were afraid of heights, supposing this percentage is valid for all Americans and responses from different individuals are independent, to determine A) what is the probability of having 3 randomly selected Americans all say that they are afraid of heights; B) what is the probability of having none of the 3 randomly selected Americans to say that they are afraid of heights; and C) what is the probability of having at least 1 of the 3 randomly selected Americans say that they are afraid of heights; the following calculations must be performed:

A)

   0.13 x 0.13 x 0.13 = X

   0.0021 = X

   100X = 0.21

B)

   100 - 13 = 87

   0.87 x 0.87 x 0.87 = X

   0.6585 = X

   100X = 65.85

C)

   0.87 x 0.87 x 0.13 = X

   0.0983 = X

   100X = 9.83Answer:

Consider the following figure ABDC with diagonal BC. Sides AB and DC are congruent angle A is congruent to angle D and sides AC and DB are congruent

Answers

Quadrilateral ABCD is both a parallelogram and a rhombus.

The figure ABDC with diagonal BC, with the congruent sides AB and DC, angle A is congruent to angle D, and sides AC and DB are congruent is a parallelogram. This is based on the definition of a parallelogram which is a quadrilateral with opposite sides that are parallel and congruent to each other.

Also, opposite angles of a parallelogram are congruent. Therefore, angle A and angle C are congruent. Additionally, angle B and angle D are also congruent because they are opposite angles of a parallelogram.The diagonal of a parallelogram cuts it into two congruent triangles.

Triangle ABD and triangle CBD are congruent triangles, since their sides are congruent, and angles A and D, and angles B and C, are congruent by the given information.

Therefore, their included angles ABD and CBD are also congruent. Because their opposite sides are congruent, quadrilateral ABCD is a rhombus. A rhombus is a parallelogram with all sides congruent. This implies that sides AB, BC, CD, and DA are all equal.

In conclusion, quadrilateral ABCD is both a parallelogram and a rhombus.

For more such questions on parallelogram, click on:

https://brainly.com/question/3050890

#SPJ8

Describe the functions and origin of mass communication.

Answers

The first function of mass communication is to serve as the eyes and ears for those seeking information about the world. The internet, televisions, and newspapers are the main sources for finding out what's going around you.

Which of the following is defined as a process that extracts DNA and inserts it into an egg to be transplanted for growth and development?


cloning

genetic transfer

duplication

genetic modification foods class

Answers

Answer:

cloning

Explanation:

Determine the value of x in the figure.
Question 11 options:

A)

x = 40

B)

x = 135

C)

x = 90

D)

x = 45

Determine the value of x in the figure.Question 11 options:A) x = 40B) x = 135C) x = 90D) x = 45

Answers

Since this is an isosceles triangle, that means that x, and the angle opposite from x, are the same. We take 135° and subtract that from 180°. That gives us 45°. Since the angle opposing x is 45°, then x is 45° as well.



So your answer is 45

x is 45

the angle right above 135 is the same as x, and the angle above 135 is 45

which part of completing the tourism skills assessment task did you struggle the most with and why

Answers

One common challenge in completing a tourism skills assessment task could be the need for a comprehensive understanding of the tourism industry.

The assessment may require knowledge of various aspects such as travel destinations, hospitality management, customer service, marketing strategies, and cultural awareness. Gathering and organizing this information accurately can be time-consuming and require extensive research.

Additionally, the assessment might include scenarios or case studies that require critical thinking and problem-solving skills. Analyzing and interpreting the given information to make informed decisions can pose a challenge, especially if the scenarios are complex or involve unfamiliar contexts.

Moreover, time management could be another difficulty. Some assessments may have time constraints, and managing time effectively to answer all questions within the given timeframe can be demanding.

To overcome these challenges, it is essential to prepare by studying relevant materials, practicing problem-solving exercises, and developing effective time management strategies.

For more questions on tourism, click on:

https://brainly.com/question/5501800

#SPJ8

P,Q,R,S and T are sitting in a row facing North.P is sitting just next to Q and R is sitting just next to S.S is not sitting with T who is on the left end of the row.R is on the second position from the right.P is to the right of Q and R.Who is sitting in between Q and R?

Answers

The seating arrangement is the logical arrangement of objects or people. To answer the questions, one must either perform the arrangement or decode the predefined arrangement using logical analysis.

How are seating plans determined?Students must arrange one group in the first row and another in the second row. The people in these rows are usually facing each other. Typically, one row faces north and the other row faces south.The seating arrangement is the logical arrangement of objects or people. To answer the questions, one must either perform the arrangement or decode the predefined arrangement using logical analysis. If it says A is sitting next to B, it means that A and B are sitting together. B could be to A's right or left. According to instructional communication theory, seating arrangements can influence how instructors communicate with students and how students interact with one another, thereby influencing engagement, motivation, and focus (McCorskey and McVetta, 1978).

Given,

P,Q,R,S and T are sitting in a row facing North.

1)  R is sitting just next to S

2) R is on the second position from the right.

3) Only T is left so the final sitting arrangement is:

Hence, T is sitting at the second position from the left end.

To learn more about sitting arrangement, refer to:

https://brainly.com/question/27935318

#SPJ1

P,Q,R,S and T are sitting in a row facing North.P is sitting just next to Q and R is sitting just next
P,Q,R,S and T are sitting in a row facing North.P is sitting just next to Q and R is sitting just next
P,Q,R,S and T are sitting in a row facing North.P is sitting just next to Q and R is sitting just next

Which institution will most likely have the lowest sticker price?

Answers

Answer:

A. Public 4-year university.

Explanation:

Hope that's right. :)

A public 4-year university is an institution which will most likely have the lowest sticker price.

What is a sticker price?

A sticker price can be defined as the official and advertised retail price of a product that is suggested by the manufacturer (institution) and printed on a sticker.

Generally, a public 4-year university is an institution which will most likely have the lowest sticker price in comparison with following institutions and items:

A certificate program.Private 4-year university.Community college.

Read more on sticker price here: https://brainly.com/question/8759334

Why were Annemarie Ellen and kirsti stopped by the soldiers

Answers

Answer:

They were stopped by soldiers because Annemarie and Ellen had a race.

In the figure above, a line passes through the point A (2,3) and never crosses the y axis. The line also passes through which of the following points?
a) (-2,3).
b) (-2,2).
c) (2,4).
d) (3,3)

Answers

Answer is c. (2,4)
Reason
(without seeing the graph)
With the same x value and a different y value the line will be straight up and down (vertical line) never crossing the y axis

A pentagon $abcde$ is translated north by 40 units to pentagon $a_1 b_1 c_1 d_1 e_1. $ pentagon $a_1 b_1 c_1 d_1 e_1$ is then translated east by 50 units to pentagon $a_2 b_2 c_2 d_2 e_2. $ we know the perimeter of pentagon $abcde$ is 30 units. Find $cc_2. $

Answers

Answer:

64.03

Explanation:

Since the pentagon is translated 40 units north and 50 units east, we can look at c, c1 and c2 as a right triangle.
cc1 = 40

c1c2 = 50

By pythagoras theorem,

cc2² = cc1² + c1c2²

⇒ cc2 = √cc1² + c1c2²

cc2 =

\(\sqrt{40^{2} + 50^{2} } \\\\\sqrt{1600 + 2500} = \sqrt{4100} \\\\= 64.03\)

A pentagon $abcde$ is translated north by 40 units to pentagon $a_1 b_1 c_1 d_1 e_1. $ pentagon $a_1

Given:A pentagon ABCDE is translated north by 40 units to pentagon A1B1C1D1E1. Pentagon A1B1C1D1E1 is then translated east by 50 units to pentagon A2B2C2D2E2. We know the perimeter of pentagon ABCDE is 30 units.

To find:\($CC_2$\)Solution:The diagram is shown below:In the above diagram, the given information is shown. Let the length of \($AE$ be $x$\).As we know that perimeter of pentagon $ABCDE$ is 30 units, so we can say that:AB + BC + CD + DE + EA = 30Since, Pentagon ABCDE is translated north by 40 units to pentagon \($A_1B_1C_1D_1E_1$.So, $A_1B_1$ = AB = $x$\)

We know that \($B_2C_2 = x$ and $B_2B = EA = x$. Therefore,$(C_2C)^2 = (x)^2 + (x)^2$$(C_2C)^2 = 2x^2$C2C = $\sqrt{2}x$Therefore, CC2 = C1C + C2C = 50 + C2C = 50 + $\sqrt{2}x$\)So, the value of \($CC_2$ is $50 + \sqrt{2}x$.\)

To know more about Pentagon visit:

https://brainly.com/question/27874618

#SPJ11

Are we expecting too much from public opinion polls? Why or why not

Answers

Answer: yes

Explanation: yes because Election indicates who wins. Public polling, done right, remains the best way of obtaining citizens opinions, and we think that if we elect a specific president we will get a better result of life. Example: Joe Biden and Donald Trump


Calculate the mass of hydrogen in 57. 010 grams of ammonium hydrogen phosphate.

Answers

The mass of hydrogen in 57.010 g ammonium hydrogen phosphate, (NH₄)H₂PO₄ is 2.97 g  

Determination of mass of 1 mole of (NH₄)H₂PO₄

1 mole of (NH₄)H₂PO₄ = 14 + (4×1) + (2×1) + 31 + (16×4) = 115 g

Determination of the mass of H in 1 mole of (NH₄)H₂PO₄

Mass of H = 6H = 6 × 1 = 6 g

Determination of the mass of H in 57.010 g of (NH₄)H₂PO₄

115 g of (NH₄)H₂PO₄ contains 6 g of H.

Therefore,

57.010 g of (NH₄)H₂PO₄ will contain = (57.010 × 6) / 115 = 2.97 g of H

Thus, 2.97 g of Hydrogen, H is present in 57.010 g of (NH₄)H₂PO₄

Learn more about mass composition:

https://brainly.com/question/13531044

For question 1-5, choose the school tool on your home page that is identified below.
a. WebMail
b. honor code
c. Virtual Library
d. school directory
e. message board

1. contains student and Learning Coach information
2. guidelines for completing and submitting work
3 your school e-mail system
4, the location of your school handbooks
5, a forum to discuss course ideas

Answers

a. Web mail - 3. Your school email system

b. honor code - 4. the location of your school handbooks.

c. Virtual library - 5. a forum to discuss course ideas.

d. School directory - 1. Contains student and learning coach information

e. message board - 2. guidelines for completing and submitting work

There can be various school tools which will help manage information of the school system.

Web mail will contain all the school emails, correspondence with the parents and students.

Honor code will have the location of school handbooks.

Virtual library is an online discussion forum where students can exchange their course ideas with each other.

School directory contains contact information of all the students.

Message board will display necessary and important information which is for every student. There can be rules and guidelines posted there so that every student reads it and abide by them.

Learn more at https://brainly.com/question/24365990

Explain (or list) at least five reasons why you will benefit from going to college or trade school.

Answers

Answer:

1. Improved job prospects:

By completing a degree or trade program, you can have access to more job opportunities and higher-paying jobs.

2. Enhanced skills and knowledge: College and trade school education can equip you with the skills and knowledge needed to excel in your chosen field.

3. Networking opportunities: Attending college or trade school can help you build professional networks that can be useful for career advancement.

4. Personal growth: College or trade school can help you develop independence, critical thinking, and other essential skills that can benefit you throughout your life.

5. Greater earning potential: Completing a college degree or trade program can lead to higher earnings and a better quality of life in the long run.

1. What properties of practice lead to mastery?
A. Amount of time
B. Quality of time
C. Effectiveness of the sessions
D. All of the above

Answers

Answer:

all of the above

Explanation:

these are all important steps leading to mastery.

D will be the correct awnser

Planets are named for the Greek word for wanderer because the planets
A) move all over the night sky.
B) move in an orbit around Earth.
C) like the stars, move across the night sky.
D) move through the field of stars a little bit each night

Answers

Five planets — Mercury, Venus, Mars, Jupiter, and Saturn were known to the ancients. ... However, the planets moved relative to the stars. For this reason they were called wandering stars. Our word "planet" comes from the Greek word planetes, meaning "wanderer."

Answer:It's D I did it in my assignment

An atom has 10 protons 15 neutrons and 10 electrons

Answers

Answer:

25 mass number

Explanation:

Which of these is important to interpreting scientific information?
O A. Bias
B. Mythology
C. Personal history
D. Reasoning

Answers

Answer:

D Reasoning.

Explanation:

The key here is that it involves scientific investigation. This must be done without bias or personal history, which only serve to taint the results. Mythology is a religion and has no place in the interpretation of scientific results.

explain the meaning of scouting

Answers

Answer:

1) the action of gathering information about enemy forces or an area.

2) the action of one that scouts

Explanation:

please mark me as brainly

Answer:

to explore an area to obtain information (as about an enemy) : to make a search. : to work as a talent scout. transitive verb. : to observe in order to obtain information or evaluate.

What are the next numbers in this pattern: 2 5 7 ... 19 ...

Answers

2,5,7,9,11,13,15,17,18,19,21,23,25,27,29,31,33,35,37,39,41

Answer: Below:

Explanation:

2 + 3 = 5

5 + 2 = 7

You add the previous number to the current one to get the next number

so the whole set is:

2, 5, 7, 12, 19, 31, 50, 81, 131, 211, 342...

there are 5,380 feet in 1 mile how many inches are in 2 miles

Answers

Answer:

There are 12 inches in 1 foot and 5,280 feet in 1 mile. Therefore, there are:

12 inches/foot x 5,280 feet/mile = 63,360 inches/mile

To find how many inches are in 2 miles, we can multiply 63,360 inches/mile by 2:

63,360 inches/mile x 2 miles = 126,720 inches

Therefore, there are 126,720 inches in 2 miles.

how is DIO alive after he was stuck in Jonathons arms and how did he get into the secret compartment without erina knowing

Answers

Right after he realized Jonathan was dead, Dio tore off his head with his hair/neck tendrils and proceeded to put his own head onto Jonathan’s body. He then dragged himself into a secret compartment inside the same bomb-proof coffin that Erina used to escape.

After Erina was rescued, the coffin was cast back into the sea, with Dio still inside. He presumably went into a state of hibernation. He waited there for nearly 100 years, until a group of fisherman off the coast of Africa happened to reel the casket in. Thinking they had discovered treasure, they opened the casket and awoke the vampire, who then christened himself as simply DIO.

Right after he recognized Jonathan existed dead, Dio tore off his head with his hair/neck tendrils and moved to put his head onto Jonathan’s body.

How is DIO alive after he was stuck in Jonathons arms?

Right after he recognized Jonathan existed dead, Dio tore off his head with his hair/neck tendrils and moved to put his head onto Jonathan’s body. He then dragged himself into a secret chamber inside the same bomb-proof coffin that Erina utilized to escape.

After Erina was rescued, the coffin existed cast back into the sea, with Dio still inside. He presumably went into a condition of hibernation. He waited there for nearly 100 years until a pack of a fisherman off the coast of Africa happened to reel the casket in. Thinking they had found treasure, they opened the casket and awoke the vampire, who then christened himself as absolutely DIO.

To learn more about How is DIO alive after he was stuck in Jonathons arms refer to:

https://brainly.com/question/26461470

#SPJ2

In the Holy bible, Noah’s ark and Solomon’s temple at Jerusalem showed units of measurement used in that period, for example cubits. What is the equivalent of each unit in SI?


PLS

Answers

The equivalent of each unit in SI of Norah's Ark was lenght=137.16m,hieght =13.71m and width= 22.86m and Solomon’s temple at Jerusalem was  lenght =27.432m,hieght =13.71m and width= 9.144m.

In the olden days, God gave Noah the dimensions for the ark in cubits. “This is how you are to make it: the length of the ark 300 cubits, its breadth 50 cubits, and its height 30 cubits” (Genesis 6:15).

The dimensions for the Jerusalem Temple King Solomon built: “60 cubits long, 20 cubits wide and 30 cubits high” (1 Kings 6:2).

the SI unit of length is Meters. Therefore 1 Cubit= 0.4572m;

Calculating  The dimensions of Noarh's Ark;

Length= 300 X 0.4572= 137.16m

Width=50 * 0.4572=22.86m

Height=30*0.4572=13.716m

Calculating the dimensions of  Solomon’s temple;

Length= 60 X 0.4572= 27.432m

Width=20 * 0.4572=9.144m

Height=30*0.4572=13.716m

Learn more about SI units on

https://brainly.com/question/10865248

#SPJ1

Other Questions
Let * be a binary operation on a set A. Assume that * is associative and that A has an identity e with respect to *. Let R be the relation on A defined as follows: if a, b element of A, then aRb if there exists an invertible element c element of A such that b = c^-1 a * c. Prove that R is an equivalence relation on A. metimes wages are set above the equilibrium level when firms pay Group of answer choices workers with more seniority higher wages than newly hired workers. efficiency wages to reduce turnover. more attractive salespeople higher wages than less attractive salespeople. compensating differentials to workers who work the night shift. chapter 5 discusses ways you can control use/reuse of your own scholarly creations. indicate whether the statements below are true or false. -You can share results of research you did at ISU in the ISU Digital Repository. - Your original works are automatically protected by copyright. - You can remix all other works that have Creative Commons licensing. Please help me with these! Research Plansource text: What it Takes to Be an Astronautsummary: In this article, the author covers the physical, intellectual, and emotional attributes required of aspiring astronauts. The author describes that, across these three areas of life, successful astronauts must be resilient and willing to learn from failure.research question: Which colleges did successful astronauts go to?research text list:My Life in Space (autobiographical book)Prerequisites to Space Travel (journal article)Colleges and Career Readiness (magazine article)presentation plan: I will create a slideshow that describes the main points of my findings and present it to my classmates. I will include images to help students understand the ideas and prepare a speech to go along with the slideshow.Select the correct answer from each drop-down menu. Review Bernadette's research plan. Then choose the correct way to complete the sentences. Bernadette's {A: summary B: research question C:presesntation plan D: research next list} needs to be improved. She can improve it by {A: preparing a more effective presentation B:shortening her summary C:finding more legitimate research texts D: Broadening her research question} Prompt:Think about certain aspects of your home that would benefit from an upgrade or change.1. Which modifications could you do on your own?2. Which could an interior decorator do?3. Which would require an interior designer? Again help please help people I believe! Do You Think matter can enter or escape in an open system or a closed system Does the royal family still have hemophilia?. is a story that helps people recognize and adapt to changing features of their environments. A scenario A simulation The Delphi technique An extrapolation The Osborn creativity model is intended to stimulate free-wheeling thinking, novel ideas, curiosity, and cooperation that in turn lead to innovative decisions True False what does each of the primary sources teach us about athenian democracy? give a specific example due by tonight help pls !! Although we did not talk about it in lecture, everyone needs to know how to design primers. Presumably you learned this skill in the prerequisite courses. For most applications, primers are on the order of 20 nts in length. For the sake of simplicity and grading, we'll just work with primers that are 5 nts in length for this particular question. Design oligonucleotide primers 5 bps in length that can be used to amplify the underlined portion of the sequence below. 5'- TCTTACGTCAGCTAGATGCATTGTGGTACCTGGTACCTGATCATACGGCA-3' 3'-AGAATGCAGTCGATCTACGTAACACCATGGACCATGGACTAGTATGCCGT-5' Your answers should be written in the 5' to 3' direction (from left to right) which best describes a gene A.chromosome B. a sister chromatid C. a tetrad D. a piece of a chromosome What are examples of self-fulfilling prophecy? With both feet flat on the floor, taking tiny Slide steps is a step pattern of what dance steps? A. shuffling steps B. contraganza step C. change step D. habanera step Please help will give brainlestQuestion 67x3-34+49x2 jalen has columbian coffee worth $3 per pound that he wishes to mix with 30 pounds of brazilian coffee worth $8 per pound to get a mixture/blend that he would sell for $4 per pound. how many pounds of the cheaper coffee should he use? the hacek group includes all of the following, except a. clostridium difficile. b. haemophilus spp. c. aggregatibacter actinomycetemcomitans. d. kingella spp. The study of perfect competition states; a firm faced with a horizontal demand curve, a. cannot affect the price it receives for its output. b. always produces at an output level where MR = MC = P. c. faces a perfectly elastic demand for its product. d. economic profit is zero in the long run. all of the above. X - [2 0 5 -1 ] = [4 10 8 3]