Please see image attached. I was told by the instructor the answer is B but I dont understand why? each daugher cell inherits a daughter strand and original template strand from parent, so shouldnt the answer be A? Why do the strands split up to each daughter cell?
Although DNA polymerases replicate DNA with extremely high fidelity, these enzymes do make mistakes at a rate of about 1 per every 100,000 nucleotides. Given that each human cell contains 23 pairs of DNA molecules with a collective 3 billion base pairs, it would amount to about 60,000 mistakes every time a cell replicates its DNA! Fortunately, there are extremely sophisticated mechanisms that fix most, but not all, of those mistakes. Suppose a cell (let's call it cell X ) in the regenerating liver of a patient is replicating its DNA molecules for mitosis, and suppose an " A " to " C " mismatch (see the sequences below) is present in one of the newly synthesized chromosome DNA because somehow this mismatch has escaped detection by repair mechanisms. Original template strand: 5'−GGTTCAGTACGATTGCAAGGCCTTAAGGT−⋯3′
Newly synthesized strand: 3'-CCAAGTCATGCTAACGCTCCGGAATTCCAA- −5′
Which one of the following statements is most likely correct? A. After mitosis of the cell X, both daughter cells possess a permanent mutation. B. After mitosis of the cell X, one daughter cell possesses a permanent mutation. C. After mitosis of the cell X, one daughter cell will possess the A−C mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once. D. After mitosis of the cell X, both daughter cells possess the A−C mismatch, which will give rise to a permanent single base mutation to be inherited by all of their daughter cells.

Answers

Answer 1

Based on the provided information and the given DNA sequences, the correct answer is C. After mitosis of cell X, one daughter cell will possess the A-C mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once.

In DNA replication, each daughter cell inherits one strand from the parent DNA molecule and one newly synthesized strand. The original template strand serves as a template for the synthesis of the complementary strand. However, in the case of a mismatched base pair like the "A" to "C" mismatch mentioned, the DNA repair mechanisms may fail to detect and correct it before the replication process is complete.

As a result, one of the daughter cells will retain the mismatched base pair in its newly synthesized strand. When this cell undergoes subsequent DNA replication, the mismatch will become a permanent mutation, leading to a single base change in the replicated DNA. This mutation will then be inherited by all the daughter cells derived from the cell with the initial mismatch.

Therefore, the correct statement is that after mitosis of cell X, one daughter cell will possess the A-C mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once (option C). The other daughter cell, which does not possess the mismatch, will have accurate replication and no permanent mutation.

To know more about DNA sequences here: https://brainly.com/question/26225212

#SPJ11

Please See Image Attached. I Was Told By The Instructor The Answer Is B But I Dont Understand Why? Each

Related Questions

How does point mutation affect the amount of DNA?

Answers

The point mutation can alter the amount of DNA sequences depending upon the type of mutation.

A point mutation is a type of mutation in which the DNA or RNA, the organism's genetic material, is altered by the addition, deletion, or modification of a single nucleotide base. The amount of DNA is unaffected by base substitution since the nucleotide count is unaffected after the substitution. The amount of DNA grows with insertions and mutations because there are more nucleotides involved, whereas it decreases with deletion mutations. A common example of substitution point mutation is sickle cell anemia.

Hence, the type of point mutation determines the amount of DNA.

To know more about Sickle cell.

https://brainly.com/question/3895081

#SPJ4

giving brainlis to the best answer​

giving brainlis to the best answer

Answers

Answer:

D

Explanation:

Answer:

D. Lipids

Explanation:

"Lipids are a class of macromolecules that are nonpolar and hydrophobic in nature. Major types include fats and oils, waxes, phospholipids, and steroids. Fats and oils are a stored form of energy and can include triglycerides. Fats and oils are usually made up of fatty acids and glycerol."

Hope this helps :)

Which of the following choices correctly shows an example of the way energy flows in an ecosystem? A. Rattlesnake to Hawk to Kangaroo Rat to Fungus to Cactus B. Fungus to Hawk toRattlesnake to Kangaroo Rat to Cactus C. Cactus to Kangaroo Rat to Rattlesnake to Hawk to Fungus D. Cactus to Fungus to Kangaroo Rat to Hawk to Rattlesnake

Answers

ANSWER:

C. Cactus to Kangaroo Rat to Rattlesnake to Hawk to Fungus

EXPLANATION

Living organisms in an ecosystem obtain energy by feeding on one another. As one organisms feeds on the other, ENERGY FLOWS. However, the flow of energy is UNIDIRECTIONAL. The flow of energy is represented by a FOOD CHAIN where the arrow signals which organism is feeding on which.

According to this question, a typical example of energy flow in a terrestrial ecosystem is as follows:

Cactus → Kangaroo rat → Rattlesnake → Hawk → Fungus

In the above food chain, energy flows as cactus plant (producer) is fed on by kangaroo rat (primary consumer), which is fed on by rattlesnake (secondary consumer), which is fed on by hawk (tertiary consumer). Hawk is decomposed by fungi (decomposer) when it dies. Energy flows in this direction.

Hence, an example of the way energy flows in an ecosystem is represented by Cactus to Kangaroo Rat to Rattlesnake to Hawk to Fungus

Which of the following choices correctly shows an example of the way energy flows in an ecosystem? A.

Traits acquired during an organisms lifetime can be passed down to its offspring true or false

Answers

Answer:

False

Explanation:

An acquired trait is the character developed in an individual as a result of environmental influence. These traits are not coded by the DNA of a living organism and therefore cannot be passed on to future generations.

A park ranger observes a deer with a huge tick on it a tick attaches to the skin of the deer and feed off the blood

Who’s the parasite and who’s the host ? Who benefits and harmed

Answers

The tick is the parasite and is benefiting and the deer is the host and is being harmed.


What is it called when rain or snowmelt seeps through soil or rock down into the aquifer?

Answers

Answer:

Groundwater

Explanation:

definition Description Of Plastic

Answers

Answer:

i need your big help begging you mark me brainlist always be happy here comes ans=

Explanation:

Plastic is defined as a material that contains an essential ingredient an organic substance of large molecular weight. It is also defined as polymers of long carbon chains. Carbon atoms are linked in chains and are produced in long-chain molecules.

Answer:

Plastic is a synthetic or semi-synthetic polymer material that is commonly used in the manufacturing of a wide range of products due to its versatility and durability. It is made up of long chains of molecules called polymers, which are formed by chemically bonding individual monomers (basic building blocks) together.

Plastic can be molded or shaped into various forms and can be made in a wide range of colors and textures. It is lightweight, strong, and relatively inexpensive to produce, which makes it ideal for use in many applications. Plastic can be found in everyday items such as water bottles, food containers, toys, electronic devices, and many other products.

While plastic has many advantages, it also poses significant environmental challenges. Plastic waste takes hundreds of years to break down and can accumulate in the environment, polluting waterways and harming wildlife. Some types of plastic also contain harmful chemicals that can leach into the environment and pose a risk to human health.

To address these challenges, there is growing interest in developing more sustainable alternatives to traditional plastic, such as biodegradable plastics made from renewable materials, as well as efforts to reduce plastic waste through recycling and other strategies.

How does the ozone layer affect life on Earth? (Site 1)


Answers

by its refraction

Explanation:

ozone layer affect life on earth by its upcoming refraction to the living life of earth

Answer:

ozone layer affect life on earth by its upcoming refraction to the living life of earth

Explanation:

Edge

DNA replication happens during which part of interphase?

Answers

Answer:

DNA replication occurs during the S phase of interphase. The S phase is the second phase of the interphase, which follows the G 1 phase.

Explanation: Interphase is the portion of the cell cycle that is not accompanied by observable changes under the microscope, and includes the G1, S and G2 phases. During interphase, the cell grows (G1), replicates its DNA (S) and prepares for mitosis (G2). A cell in interphase should not be confused with a cell in quiescent state, which represents most of the cell’s lifetime.

Answer:

Interphase

Explanation:

How are the testes and ovaries similar?

A.
Both store mature sex cells.
B.
Both produce sex cells.
C.
Both transport sex cells from their site of production.
D.
Both connect internal reproductive organs to the exterior.

Answers

The ovaries are a pair ova producing organs which leads me to answer (c)


HELP ASAP!!!


Radiation continues to be detected in the area surrounding the abandoned
nuclear power plant at Chernobyl, which experienced a nuclear accident in
1986. How does this fact illustrate a concern that people have with nuclear
energy as a source of electricity?
O A. It shows that any type of radioactive material will have harmful
effects on organisms in the environment.
O B. It shows that chain reactions are still happening in the reactors at
the nuclear power plant.
O C. It shows that radioactive materials released at nuclear power
plants remain radioactive and persist in the environment.
O D. It shows that nuclear power plants always leak a small amount of
radiation into the environment.

HELP ASAP!!! Radiation continues to be detected in the area surrounding the abandonednuclear power plant

Answers

Answer:

C)

Explanation:

I hope this helps :)

Answer:

its D.

Explanation:

just took quiz

which group of organisms (ciliates, animals, or plants) has the most complex cells?

Answers

Ciliates, a single cell of ciliate is much more complex than any one cell in our body. Thus correct answer (a) .

The alveolates known as ciliates are distinguished by the presence of cilia, which are hair-like organelles that are structurally identical to eukaryotic flagella but that are typically shorter, more numerous, and have a distinct undulating pattern.

All members of the group contain cilia, which are utilized for a variety of activities including swimming, crawling, attachment, feeding, and feeling (although the unique Suctoria only have them for a portion of their life cycle).

Are Ciliates Harmful?

Generally speaking, the environment contains free-living ciliates. There aren't many ciliates in the environment that are parasitic. The only species that may cause illness in humans is this one.

Aquaculturists may be concerned about some parasitic ciliates that are prevalent in fish and cause illness in fish. The parasites and commensals that live on invertebrates do not harm their hosts or the environment. So far as we know, ciliates are not dangerous.

Learn more about Ciliates to visit this link

https://brainly.com/question/22095567

#SPJ4

Which type of biomolecule contains phosphorus? A. Nucleic acid B. Protein C. Carbohydrate D. Lipid​

Answers

Answer: Nucleic Acids should be the answer.

Explanation:

Hydrogen, oxygen, nitrogen, carbon, and phosphorus combined and placed under one umbrella term, Biomolecule, are known as one thing; the Nucleic Acids.

How is the nitrogen cycle important to humans?
O It produces free nitrogen that humans can breathe.
O It converts nítrogen into a form that humans can obtain by eating other organisms.
O it produces nitrogen compounds that humans can breathe.
OIt converts nitrogen into a form that humans can obtain by absorbing it through their skin.

Answers

Answer: C

Explanation: it produces nitrogen compounds that humans can breath . It is the only logical choice.

It converts nítrogen into a form that humans can obtain by eating other organisms.

What is nitrogen cycle?

The conversion of nitrogen between its different life-supporting forms, including nitrates and ammonia, occurs naturally as part of the nitrogen cycle. The nitrogen cycle creates free nitrogen that people can breathe, which is one of the most significant ways it is vital to people.

Humans cannot survive without nitrogen, which is necessary for all life. Additionally, the nitrogen cycle changes nitrogen into a form that people can consume by eating other living things like plants and animals. This is significant because it enables people to obtain the essential nutrients from their diet.

The nitrogen cycle also creates nitrogen molecules for human inhalation. These substances are crucial for preserving a healthy environment and can lessen the impacts of air pollution.

Last but not least, the nitrogen cycle also changes nitrogen into a form that people can absorb via their skin. This can lower the chance of developing specific medical disorders by preserving a healthy balance of nitrogen in the body.

Learn more about nitrogen  at:

https://brainly.com/question/16711904

#SPJ5

Do you think humans have interdependent relationships with other organisms? Explain your response.

Answers

Answer:

yes, humans are the best example of interdependent relationships. unlike most organisms, humans have a pattern of staying around the same group of people and forming habits around those people while also using them codependently. not only do humans rely heavily on each other, but also on pets, that are often on the same level of dependency for emotional support as other humans. these interdependent relationships are unlike any other organism.

Explanation:

It is definitely true that humans have interdependent relationships with other organisms.

What do you mean by Organisms?

An organism may be defined as a living thing made up of one or more cells and able to carry on the activities of life.

Humans are surrounded by a variety of other organisms. These organisms are either directly or indirectly associated with humans. For example, trees give food, shade, most important oxygen to humans. Cows and buffaloes give milk, bacteria and other organisms make the soil fertile and yield high productivity of crops. Not only humans every organism in the atmosphere are interacted with others to perform all its functions.

Therefore, It is definitely true that humans have interdependent relationships with other organisms.

To learn more about Organisms, refer to the link;

https://brainly.com/question/26318876

how many different types of subunits are there in bacterial rnap holoenzyme and what are their names?

Answers

There are five different types of subunits are there in bacterial RNAP holoenzyme.

The Escherichia coli RNA polymerase (RNAP) is a multi-subunit enzyme composed of five subunits including α (two copies), β, β’ and ω subunits. These five subunits form the RNAP core enzyme responsible for RNA synthesis using DNA as template and ribonucleotide (rNTP) as substrate. For initiating promoter specific DNA transcription, the core enzyme has to bind a σ factor, which helps to direct the polymerase to specific promoters. The core polymerase with sigma factor is referred to as the holoenzyme.

To know more about Bacterial RNAP holoenzyme visit:https://brainly.com/question/28147589

#SPJ4

which term is not an example of an ecosystem?tide poolcarbon dioxideprairiedigestive system

Answers

The term that is not an example of an ecosystem is digestive system, option D is correct.

An ecosystem refers to a community of living organisms and their interactions with the abiotic (non-living) components of their environment. It encompasses the relationships between organisms and their surrounding physical and biological factors.

A tide pool is an example of an ecosystem as it consists of various organisms such as algae, crabs, and mollusks, interacting with the water, rocks, and other components of the tide pool. Carbon dioxide is not an example of an ecosystem but rather a chemical compound that is released during various natural processes and is a part of the Earth's carbon cycle. A prairie is also an example of an ecosystem as it includes a diverse range of plants, animals, and microorganisms interacting within the grassland habitat, option D is correct.

To learn more about ecosystem follow the link:

https://brainly.com/question/30243520

#SPJ4

The correct question is:

Which term is not an example of an ecosystem?

A. tide pool

B. carbon dioxide

C. prairie

D.digestive system

A scientist identifies several structures in a cell and organizes them in the
list below. Describe how the cell structures in this list can be used to
classify the cell as either prokaryotic or eukaryotic. Use examples of the
structures that would help identify the cell in your answer. *
cell structures
*cell membrane
*endoplasmic reticulum
*Golgi apparatus
*mitochondria
*nucleus
*ribosomes

Answers

nucleus golgi

Explanation:

why does dorsal protein in drosophila translocate to ventral nucleus

Answers

The translocation of the dorsal protein to the ventral nucleus in Drosophila is crucial for the establishment of dorsal-ventral patterning during embryonic development.

In Drosophila embryogenesis, the dorsal-ventral axis is established through the localization and activity of the dorsal protein. The dorsal protein is initially uniformly distributed in the cytoplasm of the embryo. However, upon activation of the Toll signaling pathway, which is triggered by the interaction between the Toll receptor and ligand, the dorsal protein undergoes translocation to the ventral nucleus.

The translocation of the dorsal protein to the ventral nucleus is facilitated by the proteolytic degradation of its cytoplasmic inhibitor, known as Cactus. Upon Toll pathway activation, Cactus is phosphorylated and targeted for degradation by the proteasome. This leads to the release of the dorsal protein, allowing it to translocate to the nucleus.

Once in the ventral nucleus, the dorsal protein acts as a transcription factor, regulating the expression of various target genes involved in dorsal-ventral patterning. Its presence in the ventral nucleus is essential for the correct specification of cell fates along the dorsal-ventral axis of the developing embryo.

Overall, the translocation of the dorsal protein to the ventral nucleus is a critical step in the signaling cascade that establishes the dorsal-ventral axis during Drosophila embryogenesis.

Learn more about dorsal protein here:

https://brainly.com/question/31560307

#SPJ11

Are mosses a direct ancestor of flowering plants?

Answers

Answer:

Mosses are not a direct ancestor of flowering plants

Explanation:

Comparing the glenohumeral and femoroacetabular joints: a. the femoroacetabular joint has a larger labrum. b. the glenohumeral joint allows more types of movements. c. he femoroacetabular joint is more likely to dislocate. d. the glenohumeral joint has a deeper socket.

Answers

Comparing glenohumeral and Femoroacetabular joints: a. the Femoroacetabular joint has a larger labrum.

What is glenohumeral and Femoroacetabular joints?

The glenohumeral joint, which consists of a complex, dynamic articulation between the proximal humerus and the glenoid of the scapula, is a ball-and-socket joint. Particularly, the glenoid cavity (or fossa) of the scapula is in touch with the head of the humerus.

The hip joint, also known as the femoroacetabular joint, is a ball-and-socket joint that connects the femur, the thighbone, to the pelvis. The socket, also known as the acetabulum, is formed by the pelvic bone's hollow and the upper portion ("head") of the femur, a round ball.

To know more about joints, refer

https://brainly.com/question/14276064

#SPJ4

Which of the following earthworm internal features is appropriately assigned as dorsal or
ventral?
A. dorsal nerve cord: ventral blood vessel
B. ventral intestine: dorsal nephridium
C. ventral nerve cord; dorsal blood vessel D. dorsal intestine; ventral nephridium

Answers

The correct answer is C. ventral nerve cord; dorsal blood vessel.

The nerve cord in earthworms runs along the length of their body and is divided into dorsal and ventral nerve cords. The ventral nerve cord is located on the underside of the worm while the dorsal nerve cord runs along the back or the dorsal side of the worm. Similarly, the blood vessels in earthworms also run along the length of their body, with the dorsal blood vessel running along the back or dorsal side of the worm, while the ventral blood vessel runs along the underside or ventral side of the worm. Therefore, the dorsal nerve cord and dorsal blood vessel are appropriately assigned as dorsal features, while the ventral nerve cord and ventral blood vessel are appropriately assigned as ventral features. The other options in the question do not match the correct dorsal-ventral assignments for the internal features of earthworms.

To know more about nerve cord visit:
https://brainly.com/question/14794571
#SPJ11

consuming ____________will help supply the phytochemicals that enhance the repair process when dna has been damaged.

Answers

Consuming fruits and vegetables will help supply the phytochemicals that

enhance the repair process when DNA has been damaged.

Phytochemicals such as flavonoids are produced by plants and they acts as

antioxidants in elimination of free radicals and in the repair process when

DNA has been damaged.

Fruits and vegetables are the primary sources of flavonoids which aids

DNA repair which is why it's the most appropriate option.

Read more about phytochemicals on https://brainly.com/question/14834940

List 2 differences between prokaryotic cells and eukaryotic cells and 2 features they have in common.

Answers

Answer:

Both the cells have a distinct plasma membrane, which protects the internal components from external damage.

There is no well-defined nucleus in the prokaryotic cell, whereas eukaryotic cells have an organized nucleus.

Which of the following is something that all living organisms have in common ?
A.) They all contain at least one cell .
B.)They all need a source of oxygen .
C.) They all use other organisms for food .
D.)They all find mates to reproduce .

Answers

Explanation:

B is absolutely correct answer.

whats another way to say '' micro livestock''?

Answers

I’m pretty sure it’s nanoscopic animal since nanospoic means extremely small and animal is another way of saying livestock so it’s nanoscopic animal or animals :) (I hope this helps you in any way)

The race is now in earnest. How do the ""discoverers"" come to their conclusion about the structure of DNA? What information did they need?

Answers

They needed the general helix structure and the symmetry 15.

The information needed by them is about its helix structure.

DNA contains the instructions needed for an organism to develop, survive and reproduce. To carry out these functions, DNA sequences must be converted into messages that can be used to produce proteins, which are the complex molecules that do most of the work in our bodies.Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. Duplication of the genetic information occurs by the use of one DNA strand as a template for formation of a complementary strand.

Learn more:

brainly.com/question/13695548

The race is now in earnest. How do the ""discoverers"" come to their conclusion about the structure of


The angle of refraction is measured between the refracted ray and what other
line?
A. The reflected ray
B. The normal
C. The incident ray
D. The boundary between the two materials

Answers

Answer:

I think b. (the normal) because in refraction calculations, angles are always measured between rays and the normal.

I think it’s a it reflects

Identify specific structure in a single celled organism. State how that structure is involved in the survival of the organism

Answers

Answer:

Pseudopodia in amoeba.

Explanation:

for locomotion

How many molecules of ATP are pro
duced by substrate-level phosphorylation from one turn of the Krebs cycle? ​

Answers

Answer:

1 mole of ATP per Krebs cycle

Explanation:

it's produced when

succinlycoa ---> succinate

( succinlycoa dehydrogenase)

you can support by rating brainly it's very much appreciated ✅✅

Other Questions
XCOf(x)-10-8-6Which is an x-intercept of the continuous function ithe table?-2-1012.3(0, -6)O (30)-4-20(-6, 0)(0,3) What is the probability of dying between ages 70 and 71? this occurs when a broker represents both sides to a transaction? please use Matlab program to solve this questionFind the matrix A for the quadratic form x} 2 x1x2 + 4 X3X2 x x} - - x 7x -14 - 2x = 8x+1 what does x equal? Census data for a certain county shows that 19% of the adult residents are Hispanic. Suppose 92 people are called to jury duty and only 11 of them are Hispanic. Does this apparent underrepresentation of Hispanics call into question the fairness of the jury selection process? Again run a test using the PHANTOMS method to complete all parts of your problem. The oxidation of the hemoglobin molecules iron ions to the ferric state (fe ) results in? the abc company is planning a new product line and a new plant to produce the parts for the line. the product line will include 8 different models. annual production of each model is expected to be 900 units. each product will be assembled of 180 components. all processing of parts will be accomplished in the new plant. on average, 6 processing operations are required to produce each component, and each operation takes an average of 1.0 min (including an allowance for setup time and part handling). all processing operations are performed at workstations, each of which includes a production machine and a human worker Key Concepts4 Identify What are three advantages of usingconceptual models?Help plz For a polynomial P(x), the quotient P(x)/(x-2) has a remainder of 12. What is the value of P(2)? Please explain. Thanks :) Helen knows how much a box of candy will cost and how much a certain book will cost. How may she find out how much money she will have left after paying for the book and the candy? 1. The Venn Diagram shows bowling scores for Sam, Bob, and Joey. Whatis the highest score for both Sam and Joey?O A) 12O B) 20C) 95D) 103 14.- A German company pays 8.000 to a French company for consulting services.Regarding the payment of VAT:a) The German company must pay VAT in France through Reverse Charge Rule???b) The French company must charge VAT and inform to the VAT InformationExchange Servicec) The French company must pay VAT in Germany through Reverse Charge Rule,and inform to the VAT Information Exchange Serviced) The German company must pay VAT in Germany through Reverse Charge Rulee) All the previous options are FALSE Email about having a new car List several things to remember when in the examination room with the patient and the electronic device that houses the emr system. specifically, what should you do, as the medical assistant, to put the patient at ease you and another provider are performing cpr on an adult patient in cardiac arrest. an advanced airway is not yet in place. which actions demonstrate appropriate care The active period of the cell cycle, during which a cell grows, DNA replicates, and new organelles form, is called ___________. It terminates when the cell begins mitosis. the pediatric nurse reviews the radiographs of a child and observes that there are lesions on the bone. the nurse interprets this finding as suggesting which condition? the connection was terminated by the remote computer before it could be completed help! :( i dont know what to put