producers part1: do you find one producer to be dominant? why might one producer be dominant over another?

Answers

Answer 1

A dominant species may outperform other species in terms of securing resources, fending off illnesses, and fending off rivals and predators.

species in a community that are more numerous than other species and have proportionate effects on the environment, community diversity, and/or ecosystem function. Dominant species may be widespread (common) or confined to a small area. The dominance of species in an ecological environment depends on a variety of variables, including temperature, groundwater quality, and moisture levels. Competition is influenced by ecological dominance.

Learn more about  dominant

https://brainly.com/question/15370906

#SPJ4


Related Questions

11. Earth's magnetic field...

does not affect solar winds

is not affected by solar winds

protects Earth from radiations

creates gravitational forces

Answers

Answer: protects Earth from radiation

Explanation:

Generated by the motion of molten iron in Earth's core, the magnetic field protects our planet from cosmic radiation and from the charged particles emitted by our Sun. It also provides the basis for navigation with a compass.

A mutation that provides a selective advantage to the mutant organism when grown in the environment in which it originated is known as a/an: Adaptive mutation Forward mutation Suppressor mutation Missense mutation Nonsense mutation

Answers

A mutation that provides a selective advantage to the mutant organism when grown in the environment in which it originated is known as an adaptive mutation.

Adaptive mutations are mutations that increase the fitness of an organism in a particular environment. They arise in response to environmental stresses, such as nutrient limitation, temperature changes, or exposure to toxins. These mutations can confer a selective advantage to the organism, allowing it to better survive and reproduce in the stressful environment. Adaptive mutations are different from suppressor mutations, which compensate for the effects of a preexisting mutation, and forward mutations, which change the phenotype of an organism. Missense mutations and nonsense mutations are types of point mutations that result in changes to the genetic code.

Know more about adaptive mutation here:

https://brainly.com/question/29352366

#SPJ11

so....... how are u?​

Answers

Answer:

Good, I guess. I just feel dead.

Explanation:

I am just bored with this quarantine, duh!

What is a enzyme and how does it work in the body

Answers

Answer:

Enzymes are proteins that help speed up chemical reactions in our bodies. Enzymes are essential for digestion, liver function and much more. Too much or too little of a certain enzyme can cause health problems. Enzymes in our blood can also help healthcare providers check for injuries and diseases.

Which of the following is the best definition of an unsaturated fatty acid? 8 A. A basic unit of a lipid that consists of single and double carbon-to- carbon bonds B. A compound that carries hereditary information C. An insoluble compound made up of glycerol and three fatty acids D. A basic unit of a lipid that consists of only single carbon-to-carbon bonds

Answers

A. Because saturated fatty acids are the ones with no double bonds

how does cellular respiration explain why animals breathe rapidly when they are running?

Answers

Cellular respiration is the process of respiration undertaken by cells of the body to convert the energy obtained from food into adenosine triphosphate (ATP) which is the energy currency of the cell.

When an animal runs, it uses up energy at a faster pace than it normally would. Nearly every part of the body is engaged in the activity of running.

This creates the need to produce more energy. The cells of the body need more oxygen as oxygen is necessary for the process of aerobic respiration and is used to oxidise the nutrients present in food in order to break them down and convert them into the easily usable ATP.

Hence, in order to inhale more oxygen, the breathing rate of the animal increases and the breaths become quicker and/or deeper. The heart rate also increases to enable the heart to pump more blood, in order to transports more of the oxygen to the cells.

Learn more about Cellular respiration

https://brainly.com/question/29760658

#SPJ4

an animal was found to have large glomeruli and short loop of henles. Account for the presence of l1 large glomeruli 2short loop of henles 3state the possible aquatic habitat

Answers

The adaptations of large glomeruli and a short loop of Henle help this animal to maintain homeostasis in a freshwater environment by allowing for increased filtration of blood and rapid reabsorption of solutes.

The presence of large glomeruli and short loop of Henle in an animal indicates that the animal is adapted to an aquatic habitat. In aquatic environments, animals need to excrete large volumes of water, but they also need to conserve ions and other valuable solutes. The large glomeruli are associated with increased filtration of blood, which allows the animal to remove excess water from its body and produce a large volume of dilute urine. This is important in aquatic environments where the animal needs to excrete large volumes of water to maintain homeostasis.

The short loop of Henle is an adaptation that allows for rapid reabsorption of ions and other solutes from the filtrate. The loop of Henle is responsible for creating a concentration gradient in the kidney, which is necessary for the reabsorption of solutes. In aquatic animals, the loop of Henle is typically shorter than in terrestrial animals because there is less need to conserve water and solutes.

The possible aquatic habitat of this animal could be a freshwater environment, such as a river or lake. In freshwater environments, animals need to excrete large volumes of water to maintain homeostasis, but they also need to conserve ions and other valuable solutes.

Know more about Homeostasis here:

https://brainly.com/question/1046675

#SPJ11

Hydrogen and oxygen are examples of which of these?

elements

compounds

molecules

none of the above

Answers

I think the answer is elements
The answer is element

Which statement describes the energy in a food web? Select three options.​

Which statement describes the energy in a food web? Select three options.

Answers

Answer:single path the last one I think cuz it can only move up

Explanation:

Answer:

Ig , second, third, and fourth,

Explanation:

hope u got it correct

2. What is the key function of RNA?

Answers

RNA converts the information in DNA into proteins

Which of these avian male animal
reproductive parts is located inside the
cloaca and deposits the sperm inside the
hen's reproductive tract for
insemination?
A. Cowper's Gland
B. Papilla
C. Seminal Vesicle
D. Male private part

Answers

Answer:

The correct answer is B. Papilla.

Explanation:

In birds, the reproductive organs are located inside the cloaca, which is a common chamber for the digestive, urinary, and reproductive tracts. The papilla is a small, nipple-like organ located inside the cloaca that is used by male birds to deposit sperm inside the female's reproductive tract for insemination. Cowper's gland, seminal vesicle, and the male private part are not associated with bird reproduction.

What is the best explanation for why scientists involved in biotechnology sometimes insert the DNA of one organism into a second organism?to make more efficient cell organellesto increase meiosisto cause the second organism to produce proteinsto create a new species

Answers

Biotechnologist use to insert DNA sequences inside other organisms to cause the second organisms to produce proteins.

Considering the other answer options, they do not do it to make more efficient cell organelles, neither to increase meiosis, nor to create new species.

Shingles that manifest themselves in close proximity to the umbilical region stem from an infection within spinal nerves emerging from which spinal segments?

Answers

Shingles that manifest themselves in close proximity to the umbilical region stem from an infection within spinal nerves emerging from the T10 spinal segment.

Shingles, also known as herpes zoster, is a viral infection caused by the varicella-zoster virus. It typically affects a single dermatome, which is an area of the skin supplied by a single spinal nerve. The umbilical region is primarily supplied by the T10 (thoracic 10) spinal segment. When shingles manifests near the umbilical region, it indicates that the infection is within the spinal nerves emerging from the T10 spinal segment. This results in the characteristic painful rash and blisters associated with shingles in the affected dermatome. The spinal nerves emerging from the T1-T12 and L1-L2 segments are responsible for innervating the chest and abdominal areas, including the umbilical region. Therefore, if the varicella-zoster virus reactivates in the dorsal root ganglia of these spinal segments, it can cause shingles to manifest near the umbilical region.

In conclusion, the spinal nerves emerging from the T1-T12 and L1-L2 segments are associated with shingles that appear near the umbilical region. It is essential to seek medical attention if you experience shingles symptoms, especially if they occur in or around the eye area, as they can lead to serious complications.

Learn more about dermatome here:

https://brainly.com/question/19579028

#SPJ11

In a Lab session, you were asked to:

1. Model one of the chemical reaction types: Synthesis, Decomposition, or replacement.
2. List the elements/ compounds you used in your reaction.
3. Describe the reaction as endothermic or exothermic. Justify your answer.
4. Record a video demonstrating the modelling.
5. Explain how a closed system is suitable for your reaction. Relate your answer to law of conservation of mass.
6. During the reaction, the reactants had a potential energy of 400 KJ. As for the final products it had 200 KJ. Demonstrate the reaction by drawing the graph.
7. Identify if the reaction is an exothermic or endothermic reaction. Explain.
8. Interpret the factors that might affect your reaction rate.

Answers

The synthesis reaction of the formation of water is an exothermic reaction because heat is given off during the reaction.

What model reaction was chosen?

The model reaction chosen is a synthesis reaction where two or more substances form another compound.

The description is as follows:

Chemical Reaction Type: Synthesis ReactionElements/Compounds used: Hydrogen gas (H2) and Oxygen gas (O2)The reaction is exothermic. When hydrogen and oxygen react to form water, energy is released in the form of heat and light. This indicates that the reaction is exothermic.A closed system is suitable for this reaction because it follows the law of conservation of mass. In a closed system, no mass is lost or gained during the reaction. The mass of the reactants equals the mass of the products. In this case, hydrogen and oxygen combine to form water, and the total mass of the reactants equals the total mass of the products. Therefore, a closed system is suitable for this reaction.The potential energy of the reactants is 400 KJ, and the potential energy of the products is 200 KJ. The graph for this reaction would show a downward-sloping line, indicating that energy is released as the reaction progresses.The reaction is exothermic because energy is released during the reaction, as indicated by the decrease in potential energy from the reactants to the products.Factors that might affect the reaction rate include temperature, pressure, and the presence of a catalyst. Increasing the temperature or pressure would increase the reaction rate, while the presence of a catalyst would decrease the activation energy required for the reaction to occur, leading to a faster reaction rate.

Learn more about exothermic reactions at: https://brainly.com/question/2924714

#SPJ1

In a Lab session, you were asked to:1. Model one of the chemical reaction types: Synthesis, Decomposition,

which vessel does the tip of central venous catheter terminate in

Answers

The tip of a central venous catheter typically terminates in the superior vena cava, which is the large vein that carries deoxygenated blood from the upper body to the right atrium of the heart.

The catheter is usually inserted into a large vein in the neck, chest, or arm, and then carefully threaded through the vein, sometimes with the aid of X-ray or ultrasound guidance, until the tip of the catheter reaches the superior vena cava. The catheter may then be used for a variety of purposes, such as delivering fluids and medications, taking blood samples, or measuring pressure in the heart chambers. The superior vena cava carries deoxygenated blood from the head and upper body to the right atrium of the heart. The catheter is inserted through a vein in the neck, arm, or chest and is used to provide access to the venous system for administering medications or fluids and drawing blood samples.

To learn more about vena cava click here https://brainly.com/question/13561968

#SPJ4

Construct a hypothesis to explain how the genes inherited by an individual can affect an individual’s health and/or cause certain genetic disorders.

Answers

A possible hypothesis to explain how inherited genes can affect an individual's health and/or cause certain genetic disorders is:

"Genetic disorders and health conditions can be caused by mutations or variations in specific genes that are inherited from parents. These mutations can alter the function or expression of proteins, enzymes, or other molecules involved in various physiological processes, leading to abnormal development, metabolism, or immune responses. The severity and manifestation of these disorders may depend on the type, location, and frequency of the mutations, as well as the interactions with other genetic or environmental factors. Therefore, understanding the genetic basis of these disorders and identifying the underlying mutations can help in diagnosing, preventing, or treating these conditions."

What is a vascular plant

Answers

Vascular plants are basically the plants which have vascular tissues. Vascular tissues are the conductive tissues which consist the xylem and the phloem which conduct water/minerals, food respectively. Most of the plants can be categorised as a vascular plant. :D

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

i don't know how to do this one

Answers

Answer:

what don't you know how to do?

Which of the following represents the product of gene expression? diploid O phenotype genotype haploid

Answers

The term ‘product of gene expression’ refers to a molecule that is created through transcription and translation after a gene has been expressed. The molecule that is synthesized represents the physical expression of genetic information contained within an organism's genome.

The product of gene expression refers to a functional gene product, such as a protein, produced through the process of gene expression. The expression of a gene involves a variety of complex molecular processes that include transcription and translation, which ultimately leads to the formation of a protein molecule from the sequence of the gene itself. The protein produced can be used to perform important functions within the organism.The term ‘diploid’ refers to a cell or organism that has two sets of chromosomes, one from each parent. The term ‘haploid,’ on the other hand, refers to a cell or organism that has only one set of chromosomes. The ‘phenotype’ is the physical manifestation of the genetic information contained within an organism’s genome. Finally, the term ‘genotype’ refers to the genetic makeup of an individual, as determined by the sequence of their DNA. None of these terms represents the product of gene expression.

To learn more about Genome visit;

https://brainly.com/question/14353558

#SPJ11

Name one basic characteristic for classifying organisms.​

Answers

Answer:

it is a kind of cell that has living organisms  that are made up of another basic characteristic

Explanation:

hope this helps

Explain why the
Hawaiian islands formed in a line. What does the general direction of the
line of islands tell you?​

Answers

For the Hawaiian Islands, the Pacific Plate is continuously moving northwest over the Hawaiian hotspot. This move led to the formation of the Hawaiian Islands.

The Hawaiian Islands are believed to have emerged from such "hot spots". As the plates move, volcanoes stop erupting and new volcanoes form in their place. Over time, the volcano continues to move westward, and he above the hotspot ages compared to one active volcano. Tectonic plates and active volcanoes in the world:

Most active volcanoes are located along or near the boundaries of Earth's moving tectonic plates. Hawaii's volcanoes, on the other hand, occur in the middle of the Pacific plate and are formed by volcanic activity over Hawaii's "hot spots."

Learn more about Hawaii in

https://brainly.com/question/14057951

#SPJ4

Compare your coding strand and your template strand. What happens when the coding strand is used for gene expression? Would this strand produce the same protein product as the template strand?

Answers

The coding strand and template strand are two complementary strands of DNA that differ in their base sequence. The coding strand is the non-template strand of DNA that has the same sequence as the RNA molecule that is produced during transcription. The template strand, on the other hand, is the template for the synthesis of RNA and has a complementary sequence to the RNA molecule.

During gene expression, the coding strand is used as a template for the synthesis of mRNA. This process is called transcription. The mRNA carries the genetic information from the DNA in the nucleus to the ribosomes in the cytoplasm, where it is translated into a protein by the process of translation. The mRNA is read in groups of three nucleotides called codons, each of which specifies a particular amino acid.

While the coding strand is used for gene expression, it does not produce the same protein product as the template strand. This is because during transcription, the mRNA is synthesized using the complementary base pairing rule. Therefore, the nucleotide sequence of the mRNA is complementary to the template strand and not the same as the coding strand. However, the genetic information contained in both strands is identical, as the sequence of the coding strand is used to determine the sequence of the mRNA.

TO KNOW MORE ABOUT The coding strand CLICK THIS LINK -

brainly.com/question/30641641

#SPJ11

which is the longest bone in human body​

Answers

Explanation:

femur

The femur is one of the most researched bones in the human anatomy and forensic medicine. As the longest bone in the human body, it is well preserved in skeletal remains.

Answer:

Femur

Explanation:

The longest bone in human body Is Femur

It is also known as Thigh Bone

-TheUnknownScientist

In gene cloning, a fragment of interest is placed into an appropriate vector and then replicates within the host cell. Which of the following is NOT an advantage to using a plasmid inserted into an E. coli bacterium for cloning?
A0 E. coli has been well studied and its genetics are very well known.
B) Plasmids can hold large inserts of DNA.
C) Plasmids can be easily inserted into E. coli and it maintains plasmids quite well.
D) E. coli is susceptible to a variety of antibiotics.

Answers

Option D - E. coli is susceptible to a variety of antibiotics is NOT an advantage to using a plasmid inserted into an E. coli bacterium for cloning.

Gene cloning is the technique of creating identical copies of a gene, usually by introducing it into a foreign host organism. It entails the insertion of a gene of interest into a suitable vector, such as a plasmid, which is then replicated inside a host cell, such as Escherichia coli.

Escherichia coli (E. coli) is often employed as a host cell for cloning because it is a widely known and thoroughly researched bacterium with genetics that are well-known. Plasmids can hold large inserts of DNA and be easily inserted into E. coli cells, which then maintain the plasmids quite well. E. coli cells are also known to grow rapidly, making it easier for scientists to quickly produce and purify the cloned gene of interest. Therefore, using plasmids in E. coli cells to replicate DNA is a popular technique for cloning genes.

However, E. coli is susceptible to a variety of antibiotics. It is important to note that while antibiotics can be used to select for bacteria that contain the desired plasmid, this is not an advantage of using plasmids in E. coli cells for cloning.

Therefore, the option D is NOT an advantage to using a plasmid inserted into an E. coli bacterium for cloning.

Read more about "Gene cloning"; https://brainly.com/question/2572556

#SPJ11

which macromolecules provide instruction for growth

Answers

The answer is nucleic acid, nucleic acids like DNA provide instructions for the growth.

Small molecules are used as the basic units in the synthesis of large food molecules.

Which statement is correct?

A. Amino acids are basic units of carbohydrates.

B. Fatty acids are basic units of glycogen.

C. Glycerol is a basic unit of oils.

D. Simple sugar is a basic unit of protein.​

Answers

B. Glycerol is a basic...

reset if during anaphase 1, n1 segregates with n2 and t1 segregates with t2, the gametes will be because each gamete will have . the n1 n2 and t1 t2 pairs are called the pairs because of their orientation in the cross-shaped diagram. other segregation patterns are possible. n1 may segregate with t2, and n2 may segregate with t1. these are called pairs because of their orientation in the diagram. less frequently, n1 may segregate with t1, and n2 may segregate with t2. these are termed pairs. the adjacent-1 and adjacent-2 combinations produce gametes that are . in each combination, and two copies of other genes exist. when this translocation heterozygote is mated with a normal individual, one can expect that about half of the zygotes will be inviable. this condition is termed .

Answers

If during anaphase 1, n1 segregates with n2 and t1 segregates with t2, the gametes will be heterozygous for the translocation. This is because each gamete will have one normal chromosome (containing n1 and t1 or n2 and t2) and one translocated chromosome (containing n2 and t1 or n1 and t2).

The n1n2 and t1t2 pairs are called the alternate pairs because of their orientation in the cross-shaped diagram. Other segregation patterns are possible, such as n1 segregating with t2 and n2 segregating with t1, which are also termed alternate pairs. Less frequently, n1 may segregate with t1 and n2 may segregate with t2, which are called adjacent pairs. The adjacent-1 and adjacent-2 combinations produce gametes that are imbalanced in each combination, and two copies of other genes exist. When this translocation heterozygote is mated with a normal individual, one can expect that about half of the zygotes will be inviable. This condition is termed semisterility.

Learn more about anaphase here:-

https://brainly.com/question/13552391

#SPJ11

our sun will end its life in a planetary nebula and become a white dwarf. true or false

Answers

True. Our sun is a main sequence star that is currently burning hydrogen into helium through nuclear fusion. Eventually, it will exhaust its supply of hydrogen and begin burning helium into heavier elements.

As it runs out of fuel, it will expand into a red giant, swelling to several times its current size and engulfing nearby planets.After expelling its outer layers, the sun will collapse into a hot, dense core known as a white dwarf. The ejected material will form a glowing cloud of gas and dust called a planetary nebula. The white dwarf will slowly cool over billions of years, eventually becoming a cold, dark object known as a black dwarf.

This process is the fate of all stars with masses less than about 8 times that of our sun. More massive stars will end their lives in more dramatic explosions called supernovae. The study of stellar evolution and the ultimate fate of stars is an important area of research in astrophysics.

To know more about white dwarf refer to

https://brainly.com/question/28346772

#SPJ11

jugular vein distention is a possible indication of

Answers

Jugular vein distention is a condition where the jugular vein, located in the neck, becomes more prominent and visible than usual. This can be a possible indication of several underlying health issues, including heart failure, lung disease, or obstruction of the veins.

In heart failure, the weakened heart is unable to pump blood efficiently, leading to a buildup of pressure in the veins and causing jugular vein distention. Similarly, in lung disease, the lungs are unable to oxygenate blood properly, causing blood to back up in the veins and leading to distention. Finally, obstruction of the veins can occur due to blood clots or other blockages, leading to jugular vein distention.

Overall, jugular vein distention is a visible sign of an underlying health issue and should prompt further medical evaluation to determine the cause and necessary treatment.

You can learn more about the Jugular vein at: brainly.com/question/30749883

#SPJ11

Other Questions
how do the direction and degree of angulation affect shape distortion True or False : There are only a few copies of the scriptures that must be considered and compared to each other. Therefore, textual accuracy is not that difficult to determine. How do I delete specific customer and restart it in qbo? What do you think it would be like to walk in the shoes of Hadorbanim, Ofra Haza, Itzhak Perlman, or any remarkable Israeli musicians and bands? Provide reasons for the statements.Given: 1 and 3 are vertical angles.Prove: 1 3(See image for more details on the equation, please.) I need the answer to this T/F. Flora's Fruit + Fresh is one of several local stores where customers can purchase locally grown fruits and vegetables. Each week, Flora also offers workshops in her store on topics such as canning, healthy eating, and growing a garden, which no other local store does. By offering these unique workshops, Flora is engaging in strategic positioning. What is the critical value t* for constructing a 95% confidence interval for a mean from a sample size of n=20 observations? Which of the following polygons is not a regular polygon? Order the following businesses based on the likelihood that the firm will be able to attain near perfect price discrimination. Order the options from least likely to most likely.Vendor selling almonds at a farmer's marketMovie theater that charges two different prices based on showtimeAutomobile dealership that negotiates a unique price for each customer Why do you think the land from Aguascalientes, Mexico is important? BRAINLIEST?Graph the line whose y-intercept is 9 and whose x-intercept is -2. A clinical psychologist has a ______ degree, a psychiatrist has a ______, and a clinical social worker has a _______. an atom of nickel has a mass of 64 amu this atom hasa) 28 protons, 28 neutrons, and 36 electronsb) 28 protons, 28 neutrons, and 28 electronsc) 28 protons, 36 neutrons, and 28 electronsd) 28 protons, 36 neutrons, and 36 electrons What are academic and emotional benefits of music? just giving random brainly Can someone help me please I'll give brainlieast Which one of the variables is most prone to errors in measurement?Select one:a. TIPAMT because it will be treated as interval scale datab. #EYECNT because it is hard to judge whether the customer thought eye contact was madec. #EYECNT because servers would have to remember all the eye contacts for all tablesd. MFPAY because sometimes it is hard to judge the sex of a persone. b and c What is the first step you should take when opening a checking account?. You and a friend are playing a game of chance. Every time you roll a 1 or 2 you are successful, and your friend will pay you $1. Every time you roll (using a fair die) a 3, 4, 5 or 6, you must pay your friend $2. If 71% of your rolls are successful and 29% of your rolls are unsuccessful, how much money do you expect to have earned/owe by the end of the game?You owe 13 centsYou have won $1.21You owe $1.21You have won 13 cents