Simplify the following expression: c + c

Answers

Answer 1

Answer:

it can be simplify by c²

Answer 2

Answer:

2c

Step-by-step explanation:


Related Questions


Which is the order from least to greatest of the following: 4/3, 0.8, 1/5, 30%?

Answers

Answer:

1/5, 30%, 0.8, 4/3

Which of the following statement justifies why the triangle shown below is not a right triangle?

Which of the following statement justifies why the triangle shown below is not a right triangle?

Answers

Answer:

The correct answer is A. \(4^{2} +12^{2} \neq 13^{2}\)

Step-by-step explanation:

A right angled triangle is the type of triangle in which one of the three angles is \(90^\circ\).

For a triangle to be right angled triangle, following equation must hold:

\(\text{Hypotenuse}^{2} = \text{Base}^{2} + \text{Height}^{2}\)

Where Hypotenuse is the largest side of triangle and is opposite to the angle with value \(90^\circ\).

Base and Height are the two other sides making an angle of \(90^\circ\) with each other.

In the given question figure, largest side, XY = 13 units

Other two sides are:

YZ = 4 units

XZ = 12 units

For this \(\triangle XYZ\) to be right angled, the following must be true:

\(XY^{2} = XZ^{2} + YZ^{2}\)

\(XY^{2} = 13^{2} = 169\)

\(XZ^{2} + YZ^{2} = 12^{2} + 4^{2}\\\Rightarrow 144 + 16\\\Rightarrow 160\)

\(160 \neq 169\)

Hence, the given triangle is not a right angled triangle because of following:

\(4^{2} +12^{2} \neq 13^{2}\)

Hence, option A. is correct answer.

Answer:

its A

Step-by-step explanation:just took test and got 100%

a data analyst creates a scatter plot in tableau and notices an outlier. what should they do next? 1 point investigate the outlier to determine if it can lead to any important observations shift the outlier to the center of the other data points for conformity use a filter to highlight the outlier, as it is more important than the rest of the data remove the outlier, as it is unlikely to lead to any important observations

Answers

The data analyst should a)investigate the outlier to determine if it can lead to any important observations and b)use a filter to highlight the outlier, as it is more important than the rest of the data.

When analyzing data, it is important to look at outliers as they can provide valuable information. Outliers can point to an unexpected correlation or reveal a hidden trend that could be missed if they were removed. By investigating the outlier, a data analyst can look for any important observations the outlier might reveal.

Additionally, using a filter to highlight the outlier allows the analyst to focus on the outlier and compare it to the other data points. This can help the analyst to understand how the outlier differs from the rest of the data and draw any relevant conclusions.

Removing the outlier should be avoided as it can lead to data bias and remove important information from the analysis.

For more questions like Data analyst click the link below:

https://brainly.com/question/28893491

#SPJ4

A city map is placed on a coordinate grid. The post office is located
at the point A(3, 8), the library is located at the point B(15,9), and
the fire station is located at the point C(21, 9.5) What is the ratio of
the length of AC to the length of BC?

Answers

The length of a segment is the number of units on the segment.

The ratio of line segment AC to line segment BC is 3 : 1

The coordinate points are given as:

\(\mathbf{A = (3,8)}\)

\(\mathbf{B = (15,9)}\)

\(\mathbf{C = (21,9.5)}\)

The length of each segment will be calculated using the following distance formula

\(\mathbf{d = \sqrt{(x_1 - x_2)^2 + (y_1 - y_2)^2}}\)

So, we have:

\(\mathbf{AC = \sqrt{(3 - 21)^2 + (8 - 9.5)^2}}\)

\(\mathbf{AC = \sqrt{326.25}}\)

Also, we have:

\(\mathbf{BC = \sqrt{(15 - 21)^2 + (9 - 9.5)^2}}\)

\(\mathbf{BC = \sqrt{36.25}}\)

The ratio of AC to BC is represented as:

\(\mathbf{AC : BC = \sqrt{326.25}:\sqrt{36.25}}\)

Divide through by \(\sqrt{36.25\)

\(\mathbf{AC : BC = \sqrt{9} : \sqrt{1}}\)

Evaluate square roots

\(\mathbf{AC : BC = 3 : 1}\)

Hence, the ratio is 3 to 1

Read more about line segments at:

https://brainly.com/question/12294171

how much energy does a 180 calorie half-pint carton of chocolate milk store

Answers

A 180 calorie half-pint carton of chocolate milk stores approximately 753.72 joules of energy.

To determine the amount of energy stored in the 180 calorie half-pint carton of chocolate milk, we can convert the calories to joules. One calorie is approximately equal to 4.184 joules. Therefore, 180 calories is equal to 180 * 4.184 = 753.72 joules.

Calories are a unit of energy commonly used in nutrition to measure the energy content of food. However, in scientific calculations and physical contexts, the SI unit for energy is the joule. So, by converting the calories to joules, we can express the energy content of the chocolate milk carton in a standard unit. Hence, a 180 calorie half-pint carton of chocolate milk stores approximately 753.72 joules of energy.

LEARN MORE ABOUT energy here: brainly.com/question/1932868

#SPJ11

Write an equation you could use to determine the price of a pizza for a given number of toppings. if you ordered your favorite medium pizza, how much would you expect to spend?

Answers

The equation to determine the price of a pizza for a given number of toppings could be represented as follows: Price = Base Price + (Price per Topping x Number of Toppings)

Let's assume the base price of a medium pizza is $10, and the price per topping is $1. If you order your favorite medium pizza with, let's say, 3 toppings, we can calculate the expected price using the equation: Price = $10 + ($1 x 3) = $10 + $3 = $13. Therefore, you would expect to spend $13 for your favorite medium pizza with 3 toppings.

The equation allows for flexibility in pricing based on the number of toppings chosen. Each additional topping incurs an extra cost, which is added to the base price of the pizza. This pricing model enables customers to customize their pizza according to their preferences and budget, as they can choose the number of toppings they desire while knowing the corresponding price.

To learn more about base price click here:

brainly.com/question/15649876

#SPJ11

Simplify the following expression. -4 × (-7) A. -28 B. -11 C. 28 D. 11

Answers

Answer:

C. 28

Step-by-step explanation:

-4×(-7)

Open bracket

-4×-7

=28

A submarine moved from the water surface at a speed of -20 m per minute . How far is the

submarine from the water surface at the end of 7 minutes?

Answers

Answer:-140 miles

Step-by-step explanation:

Which equation has no solution

A 4(x+2)=4(x-3)

B -2(x+1)=3x-2-5x

C 4 (x+1)-7x=-3(x-1)+1

-5(x-7)=2(2x+3)+x+7

Answers

Which equation has no solution

A 4(x+2)=4(x-3)

B -2(x+1)=3x-2-5x

C 4 (x+1)-7x=-3(x-1)+1

D -5(x-7)=2(2x+3)+x+7

Answer: The answer to this quesiton is A.

B-all real numbers.

C- all real numbers.

D- x=11/5

A= no solution.

so the answer would be A i hope this helps✅

Can someone help me with this question please

Can someone help me with this question please

Answers

The answer is c I really hope this helps

!!I need help seriouslyyy!!

!!I need help seriouslyyy!!

Answers

The average cost per day for the four service is $3.23 per day

What is average cost?

Average cost refers to the per-unit cost of production, which is calculated by dividing the total cost of production by the total number of units produced.

Therefore average cost = total cost/ number of unit

total cost = $108

average cost for the three services = $108/3

= $36

total average cost = $36+$54.30

= $90.30

therefore average cost for a day will be average cost for a month over 28day i.e 7days ×4

= 90.30/28

= $3.23 per day

learn more about average cost from

https://brainly.com/question/29509552

#SPJ1

. In 2000, the population of Dallas was 1,188,580. Round that number
to the nearest hundred thousand.
b. Round 3.14159 to four decimal places.
. The price of regular unleaded gasoline was $2.19 Round that price
to the nearest cent.
d. ESTIMATE Estimate the height of the ceiling in your classroom in
meters and in feet.
.. Estimate the sum of 3879 and 5276.
1. Estimate the product of 121 and 9.75 by rounding each number to the
nearest whole number before multiplying.
D. EVALUATE Gus works 39 hours for $9.85 per hour. He calculates that
his weekly paycheck should be $38,415. What is a reasonable
estimate of what Gus earns? How do you suppose Gus arrived at his
calculation?
h. A rectangular room is 11 feet long and 10 feet wide. Grace
calculated the area to be about 124 square feet. Explain why her
calculation is or is not reasonable.
1. It is 6:05 p.m, and Eduardo is driving to Dallas. If he is 157 miles away
and driving at an average speed of 62 miles per hour, is it reasonable
that he can reach Dallas by 9:00 p.m.? Explain your answer.

Answers

Answer:

please forgive me I have no clue

Step-by-step explanation:

if the geometric multiplicity of eigenvalues equal their algebraic multiplicity, is the matrix diagonalizable?

Answers

Yes, if the geometric multiplicity of each eigenvalue equals its algebraic multiplicity, then the matrix is diagonalizable.



1. Eigenvalues: Scalar values associated with a matrix that, when multiplied by a non-zero vector (eigenvector), only result in a scaled version of that vector.

2. Geometric multiplicity: The number of linearly independent eigenvectors associated with a specific eigenvalue.

3. Algebraic multiplicity: The number of times a specific eigenvalue appears as a root of the characteristic polynomial of the matrix.

4. Matrix diagonalizable: A matrix is diagonalizable if it can be transformed into a diagonal matrix through a similarity transformation (using an invertible matrix P).


A matrix is diagonalizable if and only if there are enough linearly independent eigenvectors to form a basis for the matrix's domain. This means that the sum of the geometric multiplicities of all eigenvalues must equal the dimension of the matrix. If the geometric multiplicity of each eigenvalue equals its algebraic multiplicity, it ensures that there are enough linearly independent eigenvectors to form a basis. Consequently, the matrix is diagonalizable.

Learn more about geometric multiplicity here:

brainly.com/question/29995644

#SPJ11

A polynomial f and a factor of f are given. Factor f completely.
f(x) = 3x³ + 13x²+2x-8; x + 4

Answers

Answer:

(x+4)(3x-2)(x+1)

Step-by-step explanation:

A polynomial f and a factor of f are given. Factor f completely.f(x) = 3x + 13x+2x-8; x + 4

Expand to write an equivalent expression: -12(-2x+4y)


Factor to write an equivalent expression: 26a−10

Answers

26x - 52y  is the equivalent expression.

2(13a - 5) is the equivalent expression.

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

-13 (-2x + 4y)

= -13 x -2x+ -13 x 4y

= 26x - 52y

Now,

26a - 10

Taking out a common factor.

= 2 (13a - 5)

Thus,

26x - 52y and 2(13a - 5) are the equivalent expression.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ1

Sam needs to know the height of an electricity (power) pole in his neighborhood. The pole casts a -foot shadow while he casts a -foot shadow. Sam is feet tall. The height of the electricity pole is blankfeet tall. Enter only the number

Answers

The relationship between the height of the pole and the shadow cast by the pole is a proportional relationship, from which the height of the pole can be calculated

The height of the pole is 11.\(\overline 6\) feet

What is a proportional relationship?

A proportional relationship is one in which the ratio between the elements of an ordered pair is a constant.

The example values for the lengths of the shadows and Sam's height are as follows;

Let the length of the shadow cast by the pole = 3.5 feet

Let the shadow cast by Sam = 1.5 feet

Let Sam's height = 5 feet

Sam's height and the height of the pole and their shadows have proportional relationship.

The constant of proportionality is therefore;

\(K = \dfrac{1.5}{5} =\dfrac{3.5 }{Height \, of \, the \, pole}\)

Therefore;

Height of the pole = 5 × 3.5 ÷ 1.5 = 11.\(\overline 6\)

The height of the electric pole is 11.\(\overline 6\) feet

Learn more about proportional relationships in mathematics here:

https://brainly.com/question/28761566

#SPJ1

Bella i baking 34 cookie for the holiday party tonight. She baked 18 before leaving for chool and will bake the ret when he return home. Which equation how how many cookie Bella will bake when he return home?

Answers

The equation based on the information is:

34 = x - 18

In mathematics, an equation is an expression that states that two expressions are equal by joining them with the equal sign =. Equations and their cousins ​​in other languages ​​may have subtly different meanings. For example, in French an equation is defined as containing one or more variables, whereas in English any well-formed expression consisting of two expressions joined by an equal sign is an equation. To solve an equation involving variables, it is necessary to determine which values ​​of the variables make the equation true. The variables for which the equation must be solved are also called unknowns, and the values ​​of the unknowns that satisfy the equation are called the solution of the equation. There are two types of equations: identities and constraints. The ID applies to all values ​​of the variable. A constraint expression applies only to specific values ​​of a variable.

Given that :

Bella is baking 34 cookie for the holiday party tonight. She baked 18 before leaving for school and will bake the ret when he return home.

Therefore, the equation is:

34 = x - 18

Learn more about Equation:

https://brainly.com/question/10724260

#SPJ4

A circle has a radius of 5.4 m. what is the exact length of an arc formed by a central angle measuring 60°? enter your answer in the box. express your answer using π . m

Answers

The length of the arc of the circle with a radius of 5.4 m and the central angle measuring 60° is 5.655 meters.

What is the Length of an Arc?

The length of an arc is given by the formula,

\(\rm{ Length\ of\ an\ Arc = 2\times \pi \times(radius)\times\dfrac{\theta}{360}\)

where

θ is the angle, which arc creates at the centre of the circle in degree.

The length of the arc of the circle with a radius of 5.4 m and the central angle measuring 60° can be written as

\(\text{Length of the Arc} = 2\pi r \dfrac{\theta}{360}\)

                            \(= 2 \times \pi \times 5.4 \times \dfrac{60}{360}\\\\=5.655\rm\ m\)

Hence, the length of the arc of the circle with a radius of 5.4 m and the central angle measuring 60° is 5.655 meters.

Learn more about Lenght of the Arc:

https://brainly.com/question/1577784

predict the total packing cost for 25,000 orders, weighing 40,000 pounds, with 4,000 fragile items. round regression intercept to whole dollar and coefficients to two decimal places (nearest cent). enter the final answer rounded to the nearest dollar.

Answers

The predicted total packing cost for 25,000 orders is $150,800

To predict the total packing cost for 25,000 orders,  to use the information provided and apply regression analysis. Let's assume we have a linear regression model with the following variables:

X: Number of orders

Y: Packing cost

Based on the given information, the following data:

X (Number of orders) = 25,000

Total weight of orders = 40,000 pounds

Number of fragile items = 4,000

Now, let's assume a regression equation in the form: Y = b0 + b1 × X + b2 ×Weight + b3 × Fragile

Where:

b0 is the regression intercept (rounded to the nearest whole dollar)

b1, b2, and b3 are coefficients (rounded to two decimal places or nearest cent)

Weight is the total weight of the orders (40,000 pounds)

Fragile is the number of fragile items (4,000)

Since the exact regression equation and coefficients, let's assume some hypothetical values:

b0 (intercept) = $50 (rounded)

b1 (coefficient for number of orders) = $2.75 (rounded to two decimal places or nearest cent)

b2 (coefficient for weight) = $0.05 (rounded to two decimal places or nearest cent)

b3 (coefficient for fragile items) = $20 (rounded to two decimal places or nearest cent)

calculate the predicted packing cost for 25,000 orders:

Y = b0 + b1 × X + b2 × Weight + b3 × Fragile

Y = 50 + 2.75 × 25,000 + 0.05 × 40,000 + 20 × 4,000

Y = 50 + 68,750 + 2,000 + 80,000

Y = 150,800

Keep in mind that the actual values of the regression intercept and coefficients might be different, but this is a hypothetical calculation based on the information provided.

To know more about packing here

https://brainly.com/question/15114354

#SPJ4

Can someone tell me the answer to this plz

Can someone tell me the answer to this plz

Answers

Answer:

Step-by-step explanation:jol

Suppose that a batch of 100 items contains 6 that are
defective and 94 that are not defective.
Let X be the number of defective items in a randomly selected
sample of 10 items from the
batch.
4. Suppose that a batch of 100 items contains 6 that are defective and 94 that are not defective. Let X be the number of defective items in a randomly selected sample of 10 items from the batch. (a) F

Answers

10C0 * (0.06)0 * (0.94)(10-0)= 1 * 1 * 0.547032 = 0.547, the probability that the sample does not contain any items that are defective is approximately 0.547. Option (a) is correct.

The following inquiry is addressed with the provided data: Let's say a batch contains 100 items, six of which are defective and the remaining 94 are not. Let X be the number of defective products that were selected at random from a sample of ten from the batch. Decide the likelihood that the example doesn't contain any deficient items(a) First, decide the likelihood that one irregular clump thing contains no faulty things:

We have X Bin(10, 0.06) because X has a probability of success of 0.06 and follows a binomial distribution of 10 trials. P(not defective) = number of non-defective items in the batch divided by total number of items in the batch = 94/100 = 0.94(b). Consequently, we can use the binomial probability formula to respond to the question: c) Now, replace P(X = 0) with the following numbers: nCx * px * q(n-x), where x is the number of successful trials, p is the probability of success, and q is the probability of failure (1-p).

Because P(X = 0) = 10C0 * (0.06)0 * (0.94)(10-0)= 1 * 1 * 0.547032 = 0.547, the probability that the sample does not contain any items that are defective is approximately 0.547. Option a is correct.

To know more about binomial probability refer to

https://brainly.com/question/12474772

#SPJ11

Fuel costs have risen quickly during recent years as consumption, refining and production costs have risen sharply. Supply and demand conditions in the perfectly competitive domestic crude oil market are: QS = -250 + 7P (Supply) QD = 260 - 7P (Demand) where Q is quantity in millions of barrels per day, and P is price per barrel. Find the market equilibrium price. Note: To be at equilibrium, QS must equal QD

Answers

Answer:

The market equilibrium price is approximately $36.43 per barrel.

Step-by-step explanation:

To find the market equilibrium price, we need to set the quantity supplied (QS) equal to the quantity demanded (QD) and solve for the price (P).

Given:

QS = -250 + 7P

QD = 260 - 7P

Setting QS equal to QD:

-250 + 7P = 260 - 7P

Now, let's solve for P:

Add 7P to both sides:

-250 + 7P + 7P = 260 - 7P + 7P

Combine like terms:

14P - 250 = 260

Add 250 to both sides:

14P - 250 + 250 = 260 + 250

Simplify:

14P = 510

Divide both sides by 14:

14P/14 = 510/14

Simplify:

P = 36.43

The market equilibrium price can be found by setting the quantity supplied (QS) equal to the quantity demanded (QD) and solving for the price (P) that satisfies this condition.

In the given scenario, the supply function is QS = -250 + 7P, and the demand function is QD = 260 - 7P. To find the equilibrium price, we set QS equal to QD:

-250 + 7P = 260 - 7P

Simplifying the equation, we get:

14P = 510

Dividing both sides by 14, we find:

P = 36.43

Therefore, the market equilibrium price is approximately $36.43 per barrel. At this price, the quantity supplied and quantity demanded will be equal, resulting in a state of equilibrium in the perfectly competitive domestic crude oil market.

Learn more about function here: brainly.com/question/30660139

#SPJ11

what is - 8x-6y= -8 in slope- intercept form​

Answers

Answer:

y = \(\frac{-4}{3}\) x + \(\frac{4}{3}\)

Step-by-step explanation:

-8x - 6y = -8   Add 8x to both sides

-6y = 8x  - 8   Divide all the way through by -6

y = \(\frac{-8}{6}\) c + \(\frac{8}{6}\)  Simplify

y = \(\frac{-4}{3}\) x + \(\frac{4}{3}\)

A negative times a negative is a positive.

A negative times a positive is a negative.

A car speeds up from 20 m/s to 50 m/s over a time of 10 seconds. What is the cars acceleration

Answers

Answer:

3 m/s

Step-by-step explanation:

\( \frac{50 - 20}{10} = 3\)

Someone help this question is hard and really not easy please help

Someone help this question is hard and really not easy please help

Answers

Answer:

51

it says UVW congruent to EFC

each letter here shows you where they match

u and e matches

v and f matches

w and c matches

look for the order they put the letters and they will match their corners

they are asking for FEC

the middle letter tells you the corner they are looking for, which is corner E

since E and U match, E must be 51 ° just like U

1. Sheena and her friends want to form a team to play recreational soccer. They want a combination of males and females for the soccer team. They want to have no more than 7 players on their team.
Part A: Write an inequality to represent the situation. Part B: Graph the inequality and shade the area where the possible solutions would
lie. Part C: What is the difference between the ordered pairs that fall on the line and
the ones that fall in the unshaded area?
Part D: Determine whether these combinations of males, m, and females, f, can be
present.

Answers

thx hdhdndnndjdfjfjfh

Lucy is going to walk in a fundraising event to raise money for her school band. Her mother has agreed to donate $7.50 to the school for each mile that Lucy walks, plus an additional $25.
What equation represents y, the total amount of money Lucy's mother will donate if Lucy walks x miles during the event?

Answers

Answer: y = $7.50x + $25

Step-by-step explanation:

From the question, we are informed that Lucy is going to walk in a fundraising event to raise money for her school band and her mother has agreed to donate $7.50 to the school for each mile that Lucy walks, plus an additional $25.

The equation that represents y, the total amount of money Lucy's mother will donate if Lucy walks x miles during the event will be:

= ($.750 × x) + $25

y = $7.50x + $25

Since Lucy walks x Mike's, we multiply x by $7.50 and then add the answer to the additional $25 which is the answer gotten above.

Shaloo runs along the sides of a square garden which is 85 m long. if she covers 50 cm in one how many steps will she take to run once step. round the garden

Answers

Shaloo will take 680 steps to run once around the garden.

To find the number of steps Shaloo will take to run around the square garden, we need to calculate the perimeter of the garden first. The garden is given to be 85 meters long, and since it is a square, all sides are equal. Therefore, the perimeter of the garden is 4 times the length of one side. Since the length of one side is 85 meters, the perimeter of the garden is 4 * 85 = 340 meters.
Now, we need to convert the distance covered in one step by Shaloo from centimeters to meters. Given that she covers 50 cm in one step, we can convert it to meters by dividing by 100. Thus, one step is equal to 50/100 = 0.5 meters.
To find the number of steps, we divide the perimeter of the garden by the distance covered in one step: 340 meters / 0.5 meters = 680 steps.

To know more about garden visit:

brainly.com/question/22114631

#SPJ11

Which polynomial function has a leading coefficient of 3 and roots –4, i, and 2, all with multiplicity 1? f(x) = 3(x 4)(x – i)(x – 2) f(x) = (x – 3)(x 4)(x – i)(x – 2) f(x) = (x – 3)(x 4)(x – i)(x i)(x – 2) f(x) = 3(x 4)(x – i)(x i)(x – 2)

Answers

The polynomial function with leading coefficient of 3 and root -4, i, and 2 all with multiplicity of 1 is f(x) = 3(x+4)(x-i)(x+2)

Polynomial function

The Leading coefficients are the numbers written in front of the variable with the largest exponent.

Roots of a polynomial refer to the values of a variable for which the given polynomial is equal to zero.

The multiplicity is the number of times a given factor appears in the factored form of the equation of a polynomial.

Therefore, the polynomial f(x) = 3(x+4)(x-i)(x+2) has a root -4 , 1 and -2.

The leading coefficient is 3. The multiplicity is all one.

learn more on polynomial here: https://brainly.com/question/13309002

#SPJ4

Answer:

d

Step-by-step explanation:

A calculator screen shows a number in scientific notation as 8.3E‒6. Write this number in standard form.

PLEASE HELP RIGHT AWAY!!!!!

Answers

Answer:0.0000083

Step-by-step explanation:

If a calculator screen shows a number in scientific notation as 8.3E‒6. The number in standard form is 0.0000083.

What is the  standard form?

To write the number in standard form we need to expand the scientific notation representation.

The number in scientific notation is given as 8.3E‒6,

where:

"E‒6" means "times 10 to the power of -6."

To convert it to standard form we can move the decimal point six places to the left because of the "E‒6":

8.3E‒6 = 0.0000083

OR

8.3 × 10^(-6) = 0.0000083

Therefore  the number in standard form is 0.0000083.

Learn more about standard form here:https://brainly.com/question/27896884

#SPJ3

Other Questions
help me I only have until 8:50 to finish this please help me PLEASE HELP ME PLEASE WILL MARK AS BRAINLIEST why can't we see a galaxy 15 billion light-years away? (assume the universe is 14 billion years old.) a. no galaxies exist at such a great distance. b. galaxies may exist at that distance, but their light would be too faint for our telescopes to see. c. looking 15 billion light-years away means looking to a time before the universe existed. Multiplying matrices Find AB and BA, if possible Which of the following is a single test that detects if an individual is a carrier for 500 recessive diseases? A. preconception comprehensive carrier screening B. newborn screening C. prenatal testing D. diagnostic test "Young Goodman Brown": How does Goodman Brown's experience affecthis perception of the world?A.He becomes more committed to his religion.B.He grows skeptical of the power of God.C. He falls ill from the stress of his dream.D. He becomes more suspicious of human nature. On a coordinate grid, what is the distance between (1, 3) and (6, 15)? To measure water hardness, in this experiment, we focus on measuring the ion concentration in water samples. chlorine ions sulfur ions sodium ions calcium ions ironions Hi! So I have a English Socrastic Seminar soon about the topic Logical Fallacies and I want to say some strong arguments/discussions but I don't know what to say. Can someone please make some strong statements, ideas etc!! Also like quotes and things like that to back up argumentAlso Im not the presenter by the way. Hello, I am a freshman learning algebra 1. I am studying composite and evaluate functions and I ask you kindly to look at my work for a more understandable explanation. My problem is:What is h(b(x)) given b (x) = 5x + 3 and h (x) = -x + 2 What is the range of the following data set?5, 6, 7, 3, 4, 5, 6, 8, 7A) 2B) 5C) 3D) 0 When in the company of a senior ranking person junior person shall walk or ride in what location? can someone help How would describe the people who settled Plymouth? Find positive numbers x and y satisfying the equation xy=20 such that the sum 4x+y is as small as possible. Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG What mutation changes a stop codon to an amino acid? how fast is a skater traveling in meters per second if they are moving at a rate of 5.6 mile per hour2.51m/s0.25 m/s14.24 m/s25.09 m/s Generally, under state law, business partnerships can be classified as: (check all that apply.) Which of the different levels of classification is the most specific? A. speciesB. genusC. domainD. class A person studying health sciences would most likely study which of the following?Biology PhysicsEngineering Literature