The special type of hemoglobin present in fetal red blood cells is ______.
A) hemoglobin F
B) hemoglobin B
C) hemoglobin A
D) hemoglobin S. A.

Answers

Answer 1

Hemoglobin: a protein found within red blood cells that transport oxygen from respiratory organs to the rest of the body.

Fetal hemoglobin, often referred to as Hemoglobin F, is present in red blood cells before birth. This type of hemoglobin is present in the mother's bloodstream and the blood cells carry oxygen to the baby's organs and tissues.

Therefore, option A is correct, Hemoglobin F


Related Questions

Gastroparesis is a condition that causes a partial paralysis of the stomach. The stomach has reduced ability to contract to move food through the digestive system. Some common symptoms of gastroparesis are abdominal pain, nausea, and feeling full after eating a small amount of food. What would be the most likely cause of this condition? A. damage to nerves that control the stomach B. lack of pancreatic juices and bile C. lack of enzymes in the small intestine D. damage to the mucus lining of the stomach

Answers

Symptoms of this condition include paralysis of the stomach muscles. Muscles are controlled by nerve impulses, therefore the most likely cause for this condition is (A.) damage to nerves that control the stomach

B. lack of pancreatic juices and bile -> this will lead to food not being chemically brokend down properly in the stomach and oils not mixing with water leading to malnutirion

C. Lack of enzymes in the small intestine -> this will also lead to food not being chemically digested and malnutrition

The data below was collected in the field while studying the effect of pH on the growth of
duckweed, an aquatic plant. The data shows that duckweed has optimum growth at what
pH?
Field Data
Pond
pH of Pond
Water
Number of
Duckweed
Plants
A
6
150
B
12
300
с
8
500
D
4
80

Answers

Answer: Answer is c 8 500

Explanation: Find the growth, in this case it would be 4-12. So you want to find the difference between them by subtracting the two values. 12-4=8

in salt water fish, chloride cells in the gills: question 7 options: a) actively transport cl- from the plasma to the ecf. b) actively transport cl- from the external environment to the ecf. c) actively transport cl- from the ecf to the external environment. d) passively transport cl- from the ecf to the external environment.

Answers

Chloride cells in the gills of saltwater fish actively transport chloride ions from the fish's body to the external environment, helping the fish regulate its internal chloride ion concentration and maintain ion balance in a hyperosmotic environment. The correct option is c.

In saltwater fish, chloride cells in the gills are responsible for maintaining the appropriate balance of ions, particularly chloride ions (Cl-) in the fish's body. These cells actively transport chloride ions, but the direction of transport depends on the specific concentration gradients.

When saltwater fish are in an environment with a higher chloride ion concentration outside their bodies, the chloride cells in the gills actively transport chloride ions from the external environment (saltwater) to the extracellular fluid (ECF) within the fish's body.

This helps the fish maintain a higher chloride ion concentration inside its body, necessary for osmoregulation and ion balance.

Therefore, the correct option is b) actively transport Cl- from the external environment to the ECF. The chloride cells in the gills utilize energy to pump chloride ions against their concentration gradient, ensuring that the fish retains enough chloride ions despite their constant loss through osmosis.

This active transport mechanism is essential for the survival of saltwater fish, as it enables them to regulate their internal ion concentration and counteract the osmotic stress caused by living in a hyperosmotic environment.

Hence, the correct option is c) actively transport cl- from the ecf to the external environment.

To know more about Chloride cells refer here:

https://brainly.com/question/28098581#

#SPJ11

Which term describes the cumulative amount of land and water required to provide the raw materials a person or population consumes, and to dispose of the waste that is produced

Answers

The term that describes this cumulative amount of land and water required is known as an ecological footprint.

The Global Footprint Network promotes the ecological footprint as a way to assess how much natural capital, or how much nature is required to support people and their economies, is demanded by society.Through an ecological accounting system, it monitors this demand. The accounts compare the biologically productive areas that people utilise for their consumption to the biologically productive areas that are present in a certain region, country, or even the entire globe (known as biocapacity, the productive area that can replenish the natural resources that people use). It is, in essence, a gauge for the extent of human effect on the environment and the sustainability of that impact.

To know more about ecological footprint

https://brainly.com/question/14441911

#SPJ11

lol i need help like rn

lol i need help like rn

Answers

Hey There! _____________________________________ Answer:

\(\huge\boxed{\text{Adenosine Triphosphate(ATP)}}\)

_____________________________________

\(\huge\textbf{Cellular Respiration:}\)

Cellular respiration is the process through which cells convert sugars into energy. The energy comes from the fuel molecules such as Glucose(sugar) or Lipids(fats). In cellular respiration, Glucose molecule is dismantled in the presence of oxygen. The bonds between the glucose break forming a simpler molecule and energy is released in small amounts. Some of the energy is stored by cell in the form of ATP while rest is lost as heat. So, ATP is formed from glucose through endergonic and exergonic reactions. The aerobic breakdown of glucose molecule accompanying synthesis of ATP is called celluar respiration. Carbon dioxide and water are produced as Waste Products.  

_____________________________________ Cellular Respiration Equation:

\(C_6H_{12}O_6\ +\ 6O_2\ {\longrightarrow}\ 6CO_2 +\ 6H_2O +\ (ATP + Heat)\)  

_____________________________________ Best Regards, 'Borz'

the process of converting dna to rna is called _______.

Answers

Taking the dna from another human or animal to another species and change dna

In a rain forest, it is well known that 61% of water lizards have webbed-feet which provide the ability to walk on water. Furthermore, the gene for possessing webbed-feet is not hereditary and, thus, each water lizard is independent of others. A biologist randomly selects 25 water lizards from the rain forest. Let the random variable X count the number of water lizards out of the 25 who have webbed-feet. (a) State the distribution of the random variable defined above. (b) Compute the probability that exactly 17 of the 25 selected water lizards have webbed-feet. (c) Compute the probability that at least 17 of the 25 selected water lizards have webbed-feet. (d) Compute the mean and standard deviation for the number of water lizards out of 25 who have webbedfeet. Use both to describe the typical number of water lizards out of 25 who have webbed-feet. Report 6. Suppose the number of patients per week that visit a health center follows a Poisson distribution with a rate of 300 patients per week. Let the random variable X count the number of patients that visit the health center during a randomly selected week. (a) State the distribution of the random variable defined above. (b) Compute the probability that exactly 310 patients visit the health center during a randomly selected week. (c) Compute the probability that more than 280 patients visit the health center during a randomly selected week.

Answers

The distributions of the random variables in the given scenarios are (a) binomial for the water lizards and (b) Poisson for the health center visits. The probabilities can be calculated using the respective formulas for the corresponding distributions.

(a) The distribution of the random variable X, which counts the number of water lizards out of the 25 selected with webbed feet, follows a binomial distribution.

This is because each lizard can be considered as a Bernoulli trial (success: possessing webbed feet, failure: not possessing webbed feet) with a probability of success (p) equal to 61% or 0.61, and the trials are independent.

(b) To compute the probability that exactly 17 of the 25 selected water lizards have webbed feet, we can use the binomial probability formula.

The probability mass function (PMF) for the binomial distribution is given by P(X = k) = C(n, k) * p^k * (1-p)^(n-k), where C(n, k) represents the number of combinations of n items taken k at a time. Plugging in the values, we have P(X = 17) = C(25, 17) * 0.61^17 * (1-0.61)^(25-17).

(c) To compute the probability that at least 17 of the 25 selected water lizards have webbed feet, we need to calculate the cumulative probability from 17 to 25. This can be done by summing up the probabilities for each value of X from 17 to 25: P(X ≥ 17) = P(X = 17) + P(X = 18) + ... + P(X = 25).

(d) The mean (μ) and standard deviation (σ) for the number of water lizards out of 25 who have webbed feet can be calculated using the formulas for the binomial distribution.

The mean is given by μ = n * p, where n is the number of trials (25) and p is the probability of success (0.61). The standard deviation is given by σ = sqrt(n * p * (1-p)).

Moving on to the second scenario:

(a) The distribution of the random variable X, which counts the number of patients that visit the health center during a randomly selected week, follows a Poisson distribution.

This is because the number of patients per week can be modeled as a Poisson process, where events (patient visits) occur independently and at a constant average rate (300 patients per week).

(b) To compute the probability that exactly 310 patients visit the health center during a randomly selected week, we can use the Poisson probability formula.

The probability mass function (PMF) for the Poisson distribution is given by P(X = k) = (e^(-λ) * λ^k) / k!, where λ is the average rate of the Poisson process (300 patients per week) and k is the number of events we are interested in (310 patients).

(c) To compute the probability that more than 280 patients visit the health center during a randomly selected week, we need to calculate the cumulative probability from 280 to infinity. This can be done by summing up the probabilities for each value of X from 280 to infinity: P(X > 280) = P(X = 281) + P(X = 282) + ... + P(X = ∞).

To learn more about distributions

https://brainly.com/question/23286309

#SPJ11

3-The small intestines of cows are similar in general structure and function to the small intestines of humans. A disease in cows reduces the number of villi in their small intestines. The cows lose weight and become weak, Explain.​

Answers

Reduced appetite is the cause of the weight loss and weakness.

Digestion Digestion of food and nutritional absorption.The small intestine's "villi," which resembles fingers, aids inThe bloodstream's ability to absorb nutrients from digested food. WhenNutrient absorption is decreased due to the decreased villi.Consequently, due to nutrient shortage, this causes weight loss.Due to the animal's circulation not absorbing enough nutrients(cow).Similar in general structure and operation to the small intestines of humans, cows' small intestines are similar in form and function. The quantity of villi in cows' small intestines is reduced by illness. Cows begin to thin out and weaken.

For more information on small intestine kindly visit to

https://brainly.com/question/1751875

#SPJ1

Cotyledons are tiny seed leaves of the plant embryo that contain stored food for the seed. True False

Answers

Answer:

true

Explanation:

Why do some non-'ideal' traits exist in organisms?

Answers

Explanation:

They are helpful in mate selection rather than being mostly beneficial to survival

Keep in mind what an independent variable is. What are some variables that can affect a person’s heart rate? Choose one variable that you would like to design an experiment for. State your hypothesis of how the independent variable might affect heart rate. Please be specific about what the independent variable is.

Answers

Here the experiment is on heart rate of a person

Controlled Variable:

Time

Explanation:

Both shall workout for the same time.Measure their heart rate and see who's heart rate is higher.

Independent Variable:

Age

Explanation:

Age is different for everyone and independent.Make them workout for the similar amount of time then measure their heart rate.Older person will have greater heart rate.

=================================================================

The person with less heartbeat means he has a great fitness.The person with greater heartbeat means he has a bad fitness.

People interact with their environment in many ways. And many of these interactions result in the releasing of substances that harm the environment. Generically, these substances are called

Answers

Air Pollution is a major environmental concern that affects all living things. It is caused by the release of gases and particulate matter into the atmosphere.

These pollutants can come from both natural and human sources, such as smoke from wildfires, industrial processes, and vehicle exhaust. Air pollution can cause a variety of health and environmental problems, such as asthma, respiratory illnesses, and acid rain.

Water Pollution also affects the environment and living things. It is caused by the release of pollutants into bodies of water, such as lakes, rivers, and oceans. These pollutants can come from natural sources, such as decaying organic matter and runoff from land, as well as human sources, such as sewage, industrial waste, and fertilizer. Water pollution can cause problems such as algae blooms, fish kills, and contamination of drinking water.

Land Pollution is the degradation of land due to the introduction of contaminants. These contaminants can come from a variety of sources, such as agricultural runoff, construction sites, and landfills. Land pollution can cause soil erosion and contamination, as well as damage to ecosystems, such as the destruction of forests and wildlife habitats.

Noise Pollution is the introduction of unwanted sound into the environment.

To know more about Air Pollution: https://brainly.com/question/28519286

#SPJ4

Hazardous substances. Hazardous materials (such as gasoline and pyrotechnics) can result in serious harm in the event of an accident.

Additionally, chemical emissions into the air and water can have a harmful long-term impact on the ecosystem or human health. When dangerous substances are introduced into the ecosystem, pollution occurs. Pollutants are these damaging substances. Organisms interact and make use of the resources present in each of these settings, including food, shelter, air, water, light, and heat. There are distinct interactions between each group of creatures and the individuals within it that are constrained by and can be advantageous to other organisms. A material is hazardous if it has the potential to poison someone or harm their health.

To know more about pollution, click here:

https://brainly.com/question/28519286

#SPJ4

select the correct statement regarding tissue repair. a. granulation tissue is highly susceptible to infection. b. the clot is formed from dried blood and transposed collagen fibers. c. granulation tissue is another name for a blood clot. d. histamine causes capillaries to dilate and become permeable.

Answers

c. granulation tissue is another name for a blood clot. Granulation tissue is a highly vascularized mixture of macrophages and fibroblasts embedded in a collagen and fibrin matrix.

It is crucial because it promotes early blood flow and strength to the wound, creates a surface for fibroblasts and epithelial cells to migrate on, and fights off infection. In order to repair the damaged tissues, our body automatically sets into motion a sequence of actions known as the "cascade of healing" when the skin is harmed. Hemostasis, Inflammatory, Proliferative, and Maturation are the four overlapping stages that make up the healing cascade. Inflammation is the initial step in tissue restoration. Injury to tissues causes inflammation.

To know more about Granulation, click here:

https://brainly.com/question/12993148

#SPJ4

which mode of virus transmission is the most dangerous to humans?

Answers

The airborne mode of virus transmission is considered the most dangerous to humans.

This is because viruses that are transmitted through the air can easily spread and infect a large number of people, especially in crowded places with poor ventilation.

That viruses can survive in the air for long periods of time, allowing them to infect individuals who are not in close proximity to the infected person.

Additionally, viruses that are transmitted through the air can bypass the body's natural defense mechanisms, such as the skin and digestive system, and directly enter the respiratory system.

Hence, airborne transmission poses the highest risk for the spread of viruses among humans.

learn more about airborne viruses click here:

https://brainly.com/question/18914500

#SPJ11


WRITE ABOUT A THEME: INTERACTIONS Organisms interact with each other and the physical environment. In a short essay (100-150 words), explain how the response of diatom populations to a drop in nutrient availability can affect both other organisms and aspects of the physical environment (such as carbon dioxide concentrations).

Answers

Diatoms are single-celled algae that form distinctive and beautiful cell walls from silica. They are widely distributed throughout the upper layers of the world's oceans, and can also be found in freshwater or humid environments such as the underside of plants. When nutrients are plentiful, large diatoms predominate at the trophic level of the producer, and copepods replace their diet of ciliated protists with diatoms. When nutrient levels are low, the proliferation of small algae outnumbers that of large diatoms, so copepods switch their diet and switch to feeding on ciliates.

What is the main characteristic of diatoms?

The main morphological characteristic of diatoms is the cell wall impregnated with silica (SIO2. nH2O), surrounded by a thin layer of organic matter, known as FRUSTULA.

Whit this information we can conclude that When nutrient levels are low, the proliferation of small algae outnumbers that of large diatoms, so copepods switch their diet and switch to feeding on ciliates.

Learn more about diatom populations in brainly.com/question/8058070

#SPJ1

1 milliliter (ml) is equal to how many microliters (μl)?
Select one:
a. 0.1
b. 1
c. 10
d. 100
e. 1000

Answers

To convert 1 milliliter (ml) to microliters (µl), you can follow these steps:

1. Remember that 1 milliliter is equal to 1000 microliters.
2. So, 1 ml = 1000 µl.

Based on the given options, the correct answer is:

e. 1000

To learn more about this calculation click here...

https://brainly.com/question/32138755

#SPJ11

Answer:

To convert 1 milliliter (ml) to microliters (µl), you can follow these steps:

1. Remember that 1 milliliter is equal to 1000 microliters.

2. So, 1 ml = 1000 µl.

Based on the given options, the correct answer is:

e. 1000

To learn more about this calculation click here...

https://brainly.com/question/32138755

#SPJ11

Explanation:

PLEASE HELP WITH THIS QUESTION

PLEASE HELP WITH THIS QUESTION

Answers

20..................
I learned that body cells are diploid. So it would be 10.

Brainliest if i am correct.

in the riftia worm-endosymbiotic bacteria association, the bacteria are blank , using sulfide as an electron donor and oxygen as a terminal electron acceptor. multiple choice question. chemoautotrophic chemolithotrophic chemoheterotrophic

Answers

In the Riftia worm-endosymbiotic bacteria association, the bacteria are chemoautotrophic, using sulfide as an electron donor and oxygen as a terminal electron acceptor.

Chemoautotrophic refers to organisms that use chemical energy to convert carbon dioxide into organic compounds.

They do not need light to live, but rather derive their energy from the oxidation of inorganic chemicals or the conversion of inorganic carbon to organic carbon.

They are primary producers who produce food by photosynthesis, but they do it chemically rather than with the help of sunlight.

Therefore, in the Riftia worm-endosymbiotic bacteria association, the bacteria are chemoautotrophic, using sulfide as an electron donor and oxygen as a terminal electron acceptor.

Sulfide is used as the energy source and carbon dioxide as the carbon source. Bacteria's cells use oxygen to make ATP in the electron transport chain, which provides the energy they need to grow and reproduce.

Know more about endosymbiosis - brainly.com/question/29117311

#SPJ11

The graph on the left shows how land usage changes in a region as a human population grows. The graph on the right shows biodiversity in the region at the same time.




Which statement is supported by the evidence in the graphs?

A.
As croplands decrease, biodiversity decreases.

B.
As the amount of grassland decreases, biodiversity declines.

C.
An increase in the amount of forest results in declining biodiversity.

D.
An increase in the industrial use of land results in increased biodiversity.

The graph on the left shows how land usage changes in a region as a human population grows. The graph

Answers

Answer:

Explanation:B. As the amount of grassland decreases, biodiversity declines.

This statement is supported by the evidence in the graphs. As the human population grows, more land is converted from grassland to cropland, urban areas, and other uses. As the graph on the right shows, biodiversity declines as the amount of grassland decreases. This is likely because grasslands are home to a wide variety of plant and animal species, many of which cannot survive in other types of environments. The loss of grassland habitat can have a significant impact on biodiversity, particularly for species that are specialized to this type of ecosystem.

The statement that is supported by the evidence in the graphs is that as the amount of grassland decreases, biodiversity declines. That is option B, as biodiversity is currently under threat from a range of human activities, such as habitat destruction, climate change, pollution, overfishing, and hunting.

What is biodiversity?

Biodiversity refers to the variety of living organisms, including plants, animals, fungi, and microorganisms, found in an ecosystem or on Earth. It encompasses the genetic, species, and ecosystem diversity of the planet and is a measure of the richness and complexity of life on Earth. Biodiversity is important for maintaining the ecological balance of the planet and for supporting the many ecosystem services that benefit human societies, such as air and water purification, soil formation, nutrient cycling, and climate regulation.

Hence, the statement that is supported by the evidence in the graphs is that as the amount of grassland decreases, biodiversity declines. That is option B.

Learn more about biodiversity here.

https://brainly.com/question/23101752

#SPJ5

Big Question:How is energy/matter transferred throughout an ecosystem?​

Answers

Answer:

Food webs can transfer energy because the proteins from an animal can go on, this benefits ecosystems.

what is the result of most of the growth of a plant body ?

Answers

This follows cell division, which delivers new cells generally equivalent to the first one, subsequently creating what is known as cytoplasmic development and just an unobtrusive expansion in the size of the organ.

The vast majority of the development of plants is a consequence of the extension of the vacuole.

Water is a fundamental component of plant development. They fill well with an adequate measure of water. They even answer the shortage of water. Soil Supplements: Plants require a satisfactory measure of supplements for appropriate development.

Development in plants happens as the stems and roots protract. A few plants, particularly those that are woody, likewise expand in thickness during their life expectancy. The expansion length of the shoot and the root is alluded to as essential development and is the aftereffect of cell division in the shoot apical meristem.

To learn more about  plant growth here

https://brainly.com/question/9323511

#SPJ4

the evolution of the house fly body plan was the result of several evolutionary events, which may have included organisms with the following characteristics given here in no particular order: organism 1 - 3 body segments, with a head organism 2 - 3 body segments, with a head, and wings organism 3 - many body segments, with a head organism 4 - no body segmentation, no head organism 5 - no body segmentation, with a head question: who would you consider to be the outgroup if you made a clade with organisms having these characteristics?

Answers

In considering the characteristics given, organism 4 - no body segmentation, no head - would be the most basal or outgroup.

This is because it lacks the defining characteristics of the other organisms, namely body segmentation and/or a head. In evolutionary terms, the presence of body segmentation and a distinct head are considered more advanced or derived characteristics that have evolved from simpler body plans. Organism 5 - no body segmentation, with a head - could be considered more derived than organism 4, but it still lacks body segmentation, which is a more fundamental characteristic. Organisms 1, 2, and 3 all have body segmentation and a head, but differ in the number of body segments and the presence of wings. They could be considered part of a clade that has evolved from the more basal organism 4. Overall, the evolution of the house fly body plan was likely the result of a complex series of evolutionary events involving multiple organisms and adaptations.

To know more about Organism visit:

https://brainly.com/question/13278945

#SPJ11

The current trend of increasing global temperatures has Heather wondering how an increase in the temperature of the atmosphere affects the temperature of the ocean. Heather decides to investigate the flow of energy between the atmosphere and the hydrosphere. Which investigation will provide evidence to answer the question, How does a warmer atmosphere affect the temperature of the ocean?A. Measuring the change in the temperature of water while in containers with air of different temperaturesB. Dissolving chalk in water with varying levels of acidityC. Comparing the heat capacity of water with that of other liquidsD. Testing the water solubility of various solids, such as salt and calcium carbonate

Answers

The investigation that will provide evidence to answer Heather's question about how a warmer atmosphere affects the temperature of the ocean, is by meausuring the change in the temperature of water while in containers with air of different temperatures. This will allow her to see the influence of air temperature on water temperature.

The correct option is A.

Question 18
Sponges are important in aquatic ecology and they are capable of reproducing both sexually and asexually. What
is an advantage to a species, such as the sponge, of being able to reproduce sexually?
Sexual reproduction allows the zygote to have twice the number of chromosomes of the parent.
Sexual reproduction produces a genetically improved zygote from the mutation of the parents' haploid gametes.
Sexual reproduction increases genetic variation within a species.
O Sexual reproduction produces offspring that are genetically identical to the parents.
< Previous
hp
Not saved
Next,
Submit Quiz
Time R
Attempt
10 Min

Answers

Sexual reproduction increases genetic variation within a species.

What does AOT mean in medical terms?

Answers

AOT mean in medical terms is Assisted Outpatient Treatment (AOT).

What is meant by Assisted Outpatient Treatment (AOT)?AOT laws give judges the power to require some people with brain problems to receive treatment while they are still residing in the community. Additionally and this is crucial it enables the courts to order the mental health system to pay for the treatment. Assisted outpatient treatment is the name for this court-mandated therapy. Attack on Titan attracted thousands of fans who may not have ever given anime a chance by putting itself in a westernized society and tapping into the dystopian zombie theme. Hajime Isayama also mastered the story twist and created power scale conversations that went beyond online rumors.It is harsh yet elegantly subtle, with a lot of conversation and action. It has a deep symbolic meaning and is thematically complex. The degree to which the series uses parallelism and minor details

To learn more about outpatient refer to:

https://brainly.com/question/531621

What is the action force and the reaction force when someone swims?
No link

Answers

Answer:

The action and reaction forces are reciprocal (opposite) on an object. The swimmer pushes against the water (action force), the water pushes back on the swimmer (reaction force) and pushes her forward. The ball puts a force on the wall (action force), and the wall puts a force on the ball (reaction force) so the ball bounces off.

Explanation:

Answer:

the force is push and the reaction is moving forward.

Explanation:

Is the crRNA match the
DNA in the coding region or the promoter region?
HDR-NS ODN CGCCGGCG CTGGACGTCCGTACGTTCGAACCGTGACCGGCAGCAAAATGTTGCAGCACTGACCCTTTTGG 5' GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT

Answers

The crRNA matches the DNA in the coding region.DNA is Deoxyribonucleic Acid a nucleic acid molecule that comprises a code that directs the synthesis of all proteins that make up an organism. It is composed of nucleotides that form a double helix structure.

CrRNA is a part of the CRISPR system and plays a significant role in the defense mechanism against viral infection. The crRNA provides a code to find a viral or bacterial genetic material for its degradation.

The coding region is the portion of DNA that provides information required for protein synthesis. It comprises exons and introns. The crRNA matches the DNA in the coding region in order to guide the Cas protein for the destruction of the target DNA sequences. Thus, we can conclude that the crRNA matches the DNA in the coding region.

CrRNA function in bacterial CRISPR system:

https://brainly.com/question/25558340

#SPJ11

Assume that you can track the cellular locations of these two proteins from the time that translation is complete until the proteins reach their final destinations.For each protein, identify its targeting pathway: the sequence of cellular locations in which the protein is found from when translation is complete until it reaches its final (functional) destination. (Note that if an organelle is listed in a pathway, the location implied is inside the organelle, not in the membrane that surrounds the organelle.)

Answers

a. phosphofructokinase (protein): exclusively in cytoplasm

b. Protein insulin: ER- Golgi- external cell

What is phosphofructokinase?The translation is frequently described as the process that results in the production of protein from mRNA.A protein won't need to be altered in any way to allow for easy transport to the outside of the cell if it is intended to function within the same cell.Such proteins are translated on free cytoplasmic ribosomes and sent right into the cytoplasm, where they enable the cytoplasm to carry out its functions. like the phosphofructokinase proteinA protein must be modified if it is to function on the outside of the cell where it is produced. These proteins are translated through the rough ER, modified in the Golgi complex, and then transported to the outside of the cell, where they must act similar to how insulin works.The DNA in a cell's nucleus codes for both proteins that are intended for secretion from the cell as well as proteins that are ultimately addressed to every membrane and compartment within the cell.

1. The enzyme phosphofructokinase works in the cytoplasm during glycolysis.

2. Specialized pancreatic cells secrete insulin, a molecule that controls blood sugar levels.

To know more about phosphofructokinase with the given

https://brainly.com/question/13902794

#SPJ4

which one of the following statements best describes the role of enzymes in chemical reactions? multiple choice question. enzymes catalyze chemical reactions by removing water from small molecules, allowing them to bind together to form larger molecules. enzymes catalyze chemical reactions by adding water to large molecules, splitting them into smaller molecules. enzymes catalyze chemical reactions by lowering their activation energy, allowing the reaction to proceed more rapidly or to proceed at all. enzymes catalyze chemical reactions by raising their activation energy, preventing the reaction from occurring.

Answers

Enzymes catalyze chemical reactions by lowering the activation energy, allowing the reaction to take place more quickly or even to take place at all.

What are Enzymes?

Enzymes are proteins that act as catalysts, meaning they speed up chemical reactions. Enzymes are found in all living things and are essential for life. They are specific to the reactions they catalyze, meaning they can only catalyze a specific reaction. Enzymes work by binding to the substrates of the reaction and bringing them together in the right orientation. This lowers the activation energy necessary to start the reaction and allows it to occur more quickly. Enzymes have an active site which is where the substrates bind and the reaction occurs.

To know more about Enzymes
https://brainly.com/question/14577353
#SPJ1

Which of the following is true of biogeochemical cycles?
Choose 1 answers
They ensure that nutrients are only used once by organisms.
They increase the total amount of matter over time.
They can be affected by human activity,
They create new atoms to replace lost ones.

Answers

Answer: They can be affected by human activity.

Explanation:

Answer:

a

Explanation:

i got it right

Other Questions
which of the following is not a characteristic of the normal probability distribution?a.the mean of the distribution can be negative, zero, or positive.b.the distribution is symmetrical.c.the mean, median, and mode are equal.d.the standard deviation must be 1. question 11. write a function called simulate visited area codes that generates exactly one simulated value of your test statistic under the null hypothesis. it should take no arguments and simulate 50 area codes under the assumption that the result of each area is sampled from the range 200-999 inclusive with equal probability. your function should return the number of times you saw any of the area codes of the places yanay has been to in those 50 spam calls. hint: you may find the textbook section on the sample proportions function to be useful. which of the following is added to the end of a word? The Quotient of a number and 3 10 m 11.2 m 10 m how do i find surface area Which sentence uses commas correctly?Z. It is, unfortunately, the last time that we can visit her.A. Sam, ran quickly to pick up his baby sister, because she was crying.B. The boy was not sure, why the rain had stopped, but he was happy that it had.C. The puppy was, so excited to see me, that she could not stop wagging her tail. if we start with 1.000 g of strontium-90, 0.786 g will remain after 10.0 yr. this means that the half-life of strontium-90 is ________ yr. Which of these are causes of death? There are four correct answers. If P(A) = 0.3, P(B) = 0.2, and P(A U B) = 0.46, then P(A intersect B) = .(a) Are events A and B independent? (enter YES or NO)(b) Are A and B mutually exclusive? (enter YES or NO) which of the following statements about preferred dividends is true? (you may select more than one answer. single click the box with the question mark to produce a check mark for a correct answer and double click the box with the question mark to empty the box for a wrong answer. any boxes left with a question mark will be automatically graded as incorrect.) check all that apply the two most common dividend preferences are current and cumularive.unanswered dividends on preferred stock, if any, may be paid at a fixed rate.unanswered if a company issues 10% preferred stock with a par value of $10 per share, the annual per-share dividend, if declared will equal $1.unanswered the current dividend preference requires that dividends are paid to common stockholders before any dividends are paid to preferred stockholders. Which of the following transition metal complexes is paramagnetic?[Zn(NH3)4]2+Ni(CO)4[Fe(H2O)6]3+ (high spin)[Os(NH3)6]2+ (low spin) as it pertains to your marketing plan (product or service) in the rio grande valley, how do you plan to collect consumer insights? which research techniques will you use? explain why (considering the weaknesses and strengths of different techniques such as questionnaires, interviews, observation, etc.). If the U.S. dollar appreciates, an MNC's: a. exports denominated in foreign currencies will probably increase. b. U.S. sales will probably decrease. c. interest owed on foreign funds borrowed will probably increase. d. exports denominated in U.S. dollars will probably increase. e. All of these choices are correct. Glenn carries on a business and is registered for GST. He made a taxable supply of goods in the course of his business and received $1500 in cash and goods with a market value of $700 inclusive of GST in return for the supply. What is the value of the taxable supply made by Glenn? discuss the use of 2nd person (""as you like it."" ""do you believe?"" ""do you accept?"") in omelas. how does the narrator invite the reader (""you"") to imagine the utopian city of omelas? why does the narrator want the reader to co-create this utopia? what purpose might it serve in the context of what happens later in the text? orville walks 0.327 km due east. he then continues walking along a straight line, but in a different direction, and stops 0.140 km northeast of his starting point. in what direction did he walk during the second portion of the trip? enter the angle in degrees where negative indicates north of west and positive indicates south of west. 4 letters are typed, without repetition. What is the probability that all 4 will be vowels? Write your answer asa percent. Round your answer to three decimal places.The probability is What is produced along combustion of hydrocarbons?. Lighting a match is easy when the match is quickly rubbed across a piece ofsandpaper. Which best describes the sequence of energy transformations that takeplace to light a match? Light energy to heat energyHeat and light energy tomechanical energyChemical energy tomechanical energy to lightenergy to chemical energyMechanical energy to heatenergy and then chemicalenergy to light and heatenergy A diabetic patient receives daily nph insulin 15 units subcutaneously at 0730. at what time will this medication peak?