(Urgent!) Explain how laundry detergent can be a product of biotechnology.

Answers

Answer 1

Answer:

Another important class of compounds produced by biotechnology is enzymes. One of the most significant commercial enzymes of this type is subtilisin, which is produced by a bacterium because many stains contain proteins, the manufacturers of laundry detergents include subtilisin in their product.

Explanation:

(please mark me brainliest if you can)

Answer 2

Answer:

Explanation:

Most biological laundry detergents contain lipase and protease enzymes, both of which are found in the body. Lipases break down fats and oils, while proteases work to break down protein chains. Their ability to break down these compounds makes them excellent for stain removal.


Related Questions

In the early-19th century announcement that the American continents were not subjects for future colonization by any European country.
a. True
b. False

Answers

The given statement that the declaration made in the early 19th century that no future European colonization of the American continents would take place is true.

In the early 19th century, the United States made an announcement known as the Monroe Doctrine, declaring that the American continents were not open to further colonization by any European country. This policy was put in place to protect the sovereignty of the newly independent nations in the Americas and prevent European interference.

The doctrine also stated that any attempts by European powers to colonize or interfere with countries in the Americas would be viewed as acts of aggression and provoke a response from the United States, the statement is true.

To learn more about the colonization follow the link: brainly.com/question/8933081

#SPJ4

What type of particle have the leat amount if kinetic energy?
a. Ice particle
b. Air particle
c. Skin particle
d. Liquid water particle?

Answers

The kinetic hypothesis states that matter particles are constantly in motion. Kinetic energy is the term for the energy of motion. Gas particles have the maximum kinetic energy, while solid particles have the least.

A solid's kinetic energy may be the least?

Solids have the lowest kinetic energy since they cannot move and can only vary in position relative to their mean. Although liquids have more kinetic energy than solids, they also have kinetic energy in their molecules due to convection.

What particle has the lowest energy?

When an electron and positron collided, a bottomonium particle was produced. This collision's energy resulted in the binding of a bottom quark and an anti-bottom quark.

To know more about kinetic energy visit;

https://brainly.com/question/15764612

#SPJ4

Plants require specialized cells to perform photosynthesis. A cell that provides this function would most likely have which of these characteristics?

Answers

Answer:

hope this help'sConclusion. Plant cells have certain distinguishing features, including chloroplasts, cell walls, and intracellular vacuoles. Photosynthesis takes place in chloroplasts; cell walls allow plants to have strong, upright structures; and vacuoles help regulate how cells handle water and storage of other molecules.

Give two examples of two species that are the same would compete for the

Answers

Answer:

Compete for the same what?

Evaluate the advantages of the current naming system compared to the earlier system

Answers

Answer:

This naming is essential for the classification and organization of organisms which makes the study of an organism easier and understandable. It gives the precision and clarity for the naming of an organism which prevents confusion. Scientific names help the reader to learn something about the organism.

Predict how each mutation would affect the amount (mass) of DNA in Calix's cells.
Point
Mutation
Chromosomal
Rearrangement
Nondisjunction
Mass of DNA
Increase Decrease No Change
0

Answers

The correct answers are:

Point Mutation: No change in the mass of DNA.Chromosomal Rearrangement: Possible increase or decrease in the mass of DNA.Nondisjunction: Possible increase or decrease in the mass of DNA.

Point Mutation: A point mutation refers to a change in a single nucleotide base within the DNA sequence. Depending on the specific alteration, the impact on the mass of DNA in Calix's cells can vary. In most cases, a point mutation would not significantly affect the overall mass of DNA, as it involves a substitution, insertion, or deletion of a single nucleotide.Chromosomal Rearrangement: Chromosomal rearrangements involve larger-scale changes in the structure or arrangement of chromosomes. These alterations can result in a change in the overall mass of DNA in Calix's cells. For instance, certain rearrangements, like duplications or translocations, can increase the mass of DNA due to the presence of additional genetic material and on the other hand, deletions or inversions can lead to a decrease in the mass of DNA by removing or rearranging segments of the chromosome. Nondisjunction: Nondisjunction is a mutation that occurs during cell division, leading to an abnormal distribution of chromosomes. It can result in an imbalance in the genetic material and affect the mass of DNA. In some cases, nondisjunction can cause an increase or decrease in the mass of DNA depending on whether an extra chromosome or a missing chromosome is present, respectively.

In conclusion, a point mutation typically does not affect the mass of DNA in Calix's cells, while chromosomal rearrangements and nondisjunction can potentially result in an increase or decrease in the mass of DNA.

For more such questions on DNA:

https://brainly.com/question/2131506

#SPJ8

why do scientists and engineers use the scientific notations

Answers

The main reason scientists and engineers use scientific notation is to concisely express very large and very small numbers.

This is due to the fact that using the conventional method of writing down numbers can be difficult when working with extremely big or small numbers.

For instance, it is significantly more concise to write the quantity 3 x 1010 in scientific notation as opposed to writing it as 30,000,000,000.

Scientists and engineers also benefit from scientific notation since it makes it simpler to manipulate numbers during calculations. In scientific notation, the result of multiplying 3 x 1010 by 4 x 109, for instance, can be written as 12 x 1019 rather than the verbose 30,000,000,000,000,000,000.

This is helpful when performing several calculations that call for both extremely big and extremely small quantities.

Scientific notation also makes it simple to compare and contrast various quantities. It is simpler to assess the data without being daunted or overwhelmed by the quantity of digits by expressing all the numbers in the same manner.

To learn more about scientific notation visit:

https://brainly.com/question/14903847

#SPJ4

Complex carbohydrates are sugars the body can use as a quick source of energy
True or false

Answers

Answer:

False

Explanation:

simple carbs are digested and absorbed more quickly and easily than complex carbs. Simple carbohydrates contain just one or two sugars, such as fructose (found in fruits) and galactose (found in milk products)

Yes, complex carbohydrates are made of sugar and is a quick energy source for the body. so, true.

Why was Mendel's work not accepted at the time?

Answers

Mendel's work was not accepted by most scientists when he was alive for three main reasons:

when he presented his work to other scientists he did not communicate it well so they did not really understand it
it was published in a scientific journal that was not well known so not many people read it
he could not explain the science behind why characteristics were inherited

What is the maximum concentration of salt in water for an ecosystem to be classified as a freshwater system

Answers

Answer:

Fresh water can be defined as water with less than 1000 parts per million (ppm) of dissolved salts. Other sources give higher upper salinity limits for fresh water,

Explanation:

Freshwater is characterized by a low concentration of salt as opposed to seawater. It is defined as having less than 0.05% of dissolved salts.

What is Freshwater?

Fresh water is that water which contains only a minimum amount of dissolved salts. This characteristic makes it distinct from sea water or brackish water. All types of fresh water come directly from precipitation of atmospheric water vapor into inland lakes, rivers, and groundwater bodies, or from melting snow or ice.

There are three basic types of freshwater ecosystems:

1. Lentic

It is slow moving water which includes pools, ponds, and lakes.

2. Lotic

It is faster moving water like streams and rivers.

3. Wetlands

These are the areas where the soil is saturated or inundated for at least part of the time.

Thus, freshwater is characterized by a low concentration of salt as opposed to seawater. It is defined as having less than 0.05% of dissolved salts.

Learn more about Freshwater, here:

https://brainly.com/question/1652768

#SPJ2

the energy in food is chemical energy, which can be converted into mechanical, electrical, thermal, or other forms of energy in the body. question 26 options: true false

Answers

The given statement is true.

The energy stored in food is chemical energy, which can be converted into various forms of energy within the body. When we consume food, the body breaks down the chemical bonds in the nutrients through processes like digestion and metabolism. This releases energy that can be used for mechanical work (such as muscle contractions), electrical signals (in the nervous system), thermal energy (body heat), and other physiological functions. The conversion of chemical energy from food to other forms of energy allows our bodies to perform various activities and maintain essential bodily functions.

To know more about chemical energy click here,

https://brainly.com/question/13753408

#SPJ11

Help please!! I don’t understand this.

Help please!! I dont understand this.

Answers

Answer:

1. California Sea Lion and Galapagos Sea Lion are closely related because they have the same genus Zalophus.

2. Escherichia is a Genus.

3. Fungi

Which of these graphs represents the effect of temperature on the rate of photosynthesis? Explain your answer.

WILL MARK BRAINLIEST!!

Which of these graphs represents the effect of temperature on the rate of photosynthesis? Explain your

Answers

a. A describes the effect of light intensity on photosynthesis.

Answer: A

Explanation:
In plants and other primary producers, photosynthesis is a biological mechanism that is vital to energy production. Energy-containing carbohydrates are derived from light, water and carbon dioxide in the form of glucose molecules.
The waste product oxygen is released as a result. Photosynthesis depends on many variables, including:
carbon dioxide concentration,
ambient temperature
and light intensity
It is a rate-limited reaction. Since photons or particles of light provide the energy required for the reaction, high intensities of light increase the photosynthetic rate. From the graph shown, as the intensity increases steadily, so does the rate- but at too high of an intensity, it ceases to affect the rate of photosynthesis, which becomes constant or plateaus.
Beyond this point, either the supply of carbon dioxide or the temperature limits the reaction. For instance, at high intensities tissues may even be damaged by high temperatures or heat.

Graph A represents the effect of temperature on the rate of photosynthesis.

Why is photosynthesis affected by temperature?

Photosynthesis is a biological process that is essential to the synthesis of energy in plants and other primary producers. Light, water, and carbon dioxide combine to generate glucose molecules, which are the building blocks of energy-containing carbohydrates.

As a result, the waste product oxygen is emitted. Numerous factors affect photosynthesis, such as the amount of carbon dioxide present, the surrounding temperature, and the amount of light. It is a reaction with a rate constraint. High light intensities accelerate the rate of photosynthetic reaction because photons, or light particles, supply the energy needed for the reaction. According to the graph, the rate rises steadily as the intensity does, but at a certain point, the intensity stops having an impact and the rate of photosynthesis plateaus or becomes constant.

Beyond this point, the reaction is restricted by either the temperature or the carbon dioxide supply. For instance, at high intensities, heat or high temperatures may even harm tissues.

Learn more about photosynthesis, here:

https://brainly.com/question/1388366

#SPJ2

What is the difference between environmental science and environmentalism?

Answers

Answer:

Environmental science is the pursuit of knowledge about the workings of the environment and our interactions with it. Environmentalism is a social movement dedicated to protecting the natural world.

Explanation:

female puberty usually begins with question 4 options: the budding of the breasts and the growth spurt. menarche. the completion of pubic hair growth.

Answers

Female puberty usually begins with the budding of the breasts and the growth spurt, followed by the onset of menarche, which typically occurs around 2-3 years after the start of breast development and pubic hair growth.
Female puberty usually begins with the budding of the breasts and the growth spurt. Menarche, which is the onset of menstruation, typically occurs later in the puberty process.

Female puberty is a time when girls transform into young women and when physical and physiological changes take place. The exact date varies for each person and commonly begins between the ages of 8 and 13.

The development of the breasts during female puberty is one of the first observable changes. This is the earliest formation of breast tissue, which manifests as little bumps or buds under the nipples. Thelarche or breast blossoming are terms for this phase. It can happen as early as age 8 or as late as age 13, and is frequently one of the first indicators of female puberty.

To know more about Female puberty Visit:

https://brainly.com/question/8732338

#SPJ11

2. Would a sea otter catch these prey items alone or with help from others? Using the quantitative data provided in
Table 1 below, prove which method of hunting your sea otter must utilize to obtain its daily energy needs. You
will answer this question on the next page when you complete your Claim-Evidence-Reasoning but you must first
work out the math below. Using the "observed sea otter diet" above, calculate the energy consumed to
determine if it satisfies this female's daily needs.
Table 1
Individual food item
Clam
Mussel
Urchin
Crab
Mollusk (small octopus or snail)
OBSERVED SEA OTTER DIET: After observing the same female sea
otter for a day, you collected the following feeding data:
40 urchins, 12 mussels and 4 crabs.
print privile
Average mass of individual prey (kg)
0.057
0.085
0.099
0.085
0.080
Energy available per prey (kcal)
40
75
126
80
70
Show your work here using the data in Table 1 to calculate the energy consumed by this female sea otter:

Answers

Sea otters eat 25 percent of their body weight each day in the form of sea urchins, crabs, mussels, clams, snails and other invertebrates.

1 urchin that weighs around 15 grams provides 20 calories of energy.

So,

40 urchins = 800 calories of energy.

Similarly,

1 mussel = 146 calories of energy.

So,

12 mussels = 1752 calories of energy.

And,

1 crab = 381 calories of energy

So,

4 crabs = 1524 calories of energy

Hence, the total amount of calories consumed by the sea otter is equals,

= 4076 calories of energy per day approximately.

Female otter needs about 7,500 calories per day.

Therefore, the given diet does not satisfy this female otter's daily needs.

Learn more about otters here:

https://brainly.com/question/2724168

#SPJ9

Juliette is selling candy bars for a fundraiser for her club each box comes with 60 candy bars for $50 before tax of 9. 75% she plans to sell each bar for 175% of what she pays for them after tax

Answers

Juliette plans to sell each candy bar for 175% of what she pays for them after a 9.75% tax.

Juliette purchases a box of 60 candy bars for $50 before tax. The tax rate is 9.75%, so she needs to calculate the price after tax. To do this, she multiplies the original price by (1 + tax rate) to get the final price. In this case, the final price after tax would be $50 * (1 + 0.0975) = $54.87.  Next, Juliette plans to sell each candy bar for 175% of what she pays for them after tax. To calculate the selling price, she multiplies the final price after tax by 1.75. In this case, the selling price would be $54.87 * 1.75 = $95.99.  Therefore, Juliette plans to sell each candy bar for $95.99 after tax, which is 175% of what she pays for them. This allows her to make a profit for her club's fundraiser.

learn more about profit  here:

https://brainly.com/question/32381738

#SPJ11

Specify the coordinate system (Cartesian, cylindrical, spherical) you would use, along with any relevant assumptions, when modeling transport processes in each of the following scenarios: loss of energy through a flat double-pane window C. transfer of dissolved oxygen from a culture medium into sphere-shaped cells the fluid motion produced when stirring coffee in a typical mug d. dissipation of energy from the skin of a tall and skinny person the velocity profile in waves about to crash on a flat shore f. heating of a cold bottle of alcoholic cider by a warm hand e

Answers

The rectangular coordinate system is another name for the Cartesian coordinate system. It is a system used in geometry that employs coordinates to establish the location of a geometric component (such a point, for instance). Each location in this system is described by two numerical coordinates.

The following coordinate systems are used in each of the given scenarios:

A. Loss of energy through a flat double-pane window Cartesian coordinate system is used to model transport processes in the scenario of energy loss through a flat double-pane window. The major assumptions include that the process is symmetrical, the heat transfer coefficient is uniform, and the heat transfer is two-dimensional.

B. Transfer of dissolved oxygen from a culture medium into sphere-shaped cells Spherical coordinate system is used to model the transport processes in the transfer of dissolved oxygen from a culture medium into sphere-shaped cells. The assumptions include that the rate of oxygen transfer is uniform, the cells are symmetrical, and the diffusivity of oxygen is constant.

C. Fluid motion produced when stirring coffee in a typical mug cylindrical coordinate system is used to model the transport processes of fluid motion produced when stirring coffee in a typical mug. The assumptions include that the flow is two-dimensional, the flow is symmetrical, and the viscosity of the fluid is constant.

D. Dissipation of energy from the skin of a tall and skinny person Cartesian coordinate system is used to model the transport processes in the dissipation of energy from the skin of a tall and skinny person. The assumptions include that the surface temperature is uniform, the surface is symmetrical, and the heat transfer coefficient is uniform.

E. Heating of a cold bottle of alcoholic cider by a warm hand cylindrical coordinate system is used to model the transport processes of heating of a cold bottle of alcoholic cider by a warm hand. The assumptions include that the flow is two-dimensional, the flow is symmetrical, and the viscosity of the fluid is constant.

F. Velocity profile in waves about to crash on a flat shore Spherical coordinate system is used to model the transport processes in the velocity profile in waves about to crash on a flat shore. The assumptions include that the waves are symmetrical, and the diffusivity is constant.

know more about coordinate systems.

https://brainly.com/question/4726772

#SPJ11

Mr. Wingate is a newly enrolled medicare part d beneficiary and one of your clients. In addition to drugs on his plan’s formulary he takes several other medications. These include a prescription drug not on his plan’s formulary, over-the-counter medications for colds and allergies, vitamins, and drugs from an internet-based canadian pharmacy to promote hair growth and reduce joint swelling. His neighbor recently told him about a concept called troop and he asks you if any of his other medications could count toward troop should he ever reach the part d catastrophic limit. What should you say?.

Answers

The cost of the prescription drugs that are not on his plan’s formulary and the cost of the drugs to reduce joint swelling will count toward troop.

What is Drug?

This is a substance which effects changes in the psychological or physiological state of an organism.

The cost of the prescription drugs that are not on his plan’s formulary and the cost of the drugs to reduce joint swelling will count toward troop while the others will not.

Read more about Drugs here https://brainly.com/question/1189815

Answer The cost of the prescription drug that is not on his plan’s formulary will count toward TrOOP but the other medications in question will not count toward TrOOP.

Explanation:

I need the answer for number 4

I need the answer for number 4

Answers

Answer:

chicken wings I believe

I believe it would be butter

Need help asap please :(

Need help asap please :(

Answers

Answer:

picture quality is low

Explanation:

write your question

2. What forms the start, or bottom, of the food web at these hydrothermal
vents?
a. vent shrimp
b. yeti crabs
O c. bacteria
O d. barnacles

Answers

2. What forms the start, or bottom, of the food web at these hydrothermal
vents?
a. vent shrimp
b. yeti crabs
O c. bacteria
O d. barnacles

Answer:c.bacteria

What are organisms that feed on dead animals and wastes?

Answers

Organisms that feed on dead animals and wastes are known as decomposers.

Decomposers play a crucial role in ecosystems by breaking down dead organisms and organic waste materials, recycling nutrients back into the environment. They are responsible for the process of decomposition, which involves the physical and chemical breakdown of organic matter. Decomposers include various types of organisms such as bacteria, fungi, and some invertebrates. Bacteria are the primary decomposers, utilizing enzymes to break down complex organic molecules into simpler compounds.

Fungi, like mushrooms and molds, also play a significant role in decomposition, as they can break down tough materials such as lignin and cellulose. Invertebrates like earthworms, beetles, and maggots contribute to the decomposition process by physically breaking down organic matter and increasing its surface area for microbial action. Overall, decomposers are essential for nutrient recycling and maintaining the balance of ecosystems by efficiently decomposing dead animals and wastes.

Learn more about invertebrates here:

https://brainly.com/question/13285943

#SPJ11

16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe

Answers

The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.

What is Mutation?

Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.

Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.

In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process,  mutation frameshift.

Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.

Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.

Learn more about mutation, here:

https://brainly.com/question/17130462

#SPJ4

Help


Did you know that you can't just put "help" as your question?

Help Did you know that you can't just put "help" as your question?

Answers

dang i never knew that

What do the arrows in a food chain represent?

Answers

Answer:

The transfer of energy/ What animal eats who

Explanation:

Answer:

The energy transfer to them when the animal eats them

Explanation:

Compounds like the pesticide DDT may bring about the evolution of new strains of organisms by...?
(1) destroying food producers
(2) acting as natural selecting agent
(3) mixing two different sets of genes
(4) creating new ecological niches

Answers

Answer:

(2) acting as natural selecting agent

Explanation:

Compounds like the pesticide DDT may bring about the evolution of new strains of organisms by acting as a natural selecting agent.

Evolution is generally defined as a gradual change to the characteristics of organisms over a period of time.

When DDT is used on a particular population of pest, those that are weak within the population die off, leaving only those that are strong within the population to survive and multiply. The DDT acts a selecting agent for the survival gene in the pest and the survived gene eventually evolve into a new, DDT-resistant strain pest in no time.

The correct option is option (2).

which statement is true about malignant tumors? they grow by expansion. they demonstrate cells that are well differentiated. they gain access to the blood and lymphatic channels. they usually grow slowly.

Answers

Answer:

I would go with C. They gain access to the blood and lymphatic.

Explanation:

We can rule out the last one "they usually grow slowly" because they grow quickly. It does access to the bloodstream and lymphatic channels.

Hope this helps. Sorry if I'm not right

g intracellular receptors are activated by signaling molecules that bind to the click to select. in extracellular signaling, ligands bind to click to select. most types of enzyme-linked receptors function as click to select. in mammals, receptors for click to select are intracellular.

Answers

Intracellular receptors respond to intracellular ligands, while extracellular receptors respond to extracellular ligands, and enzyme-linked receptors function primarily as cell surface receptors in mammals.

How do intracellular and extracellular receptors differ in mammals?Intracellular receptors are activated by signaling molecules that bind to them inside the cell.Extracellular signaling involves ligands binding to receptors on the cell surface.Enzyme-linked receptors primarily function as cell surface receptors.In mammals, receptors for intracellular signaling molecules are located inside the cell.Intracellular receptors respond to intracellular ligands.Extracellular receptors respond to extracellular ligands.Enzyme-linked receptors are commonly found on the cell surface.Activation of enzyme-linked receptors triggers intracellular signaling pathways.Mammals possess intracellular receptors that regulate various cellular processes by responding to signaling molecules within the cell.

Learn more about Intracellular receptors

brainly.com/question/32097485

#SPJ11

what do Prokaryotes and Eukaryotes have the same of?

Answers

Both have a nucleus.

Other Questions
what is 12+[(14-6)/4] was Georgia O'Keeffe was influenced by Kandinsky - infinite < p < infinite Graph the solution on a number line No solutionGraph the solution on a number line What are problems with polling ?. Which of the following occurred after the Berlin Wall fell?Europe remained divided among ideological lines.The European Union collapsed.All European nations became members of NATO.Much of Europe formed a single economic market. the density of salt is 80 pounds per cubic foot what is the approximate density of salt per cubic meter This is a hard one for me. Can someone solve this one. The scale of a map says that 4cm represents 5m in real life.What is the actual number of kilometers that is represented by 16 centimeters on the map The commitment of americans to individualism is a reflection of american __________. suppose today a mutual fund contains 2,000 shares of jpmorgan chase, currently trading at $64.75, 1,000 shares of walmart, currently trading at $63.10, and 2,500 shares of pfizer, currently trading at $31.50. the mutual fund has no liabilities and 20,000 shares outstanding held by investors. what is the nav of the fund? suppose today a mutual fund contains 2,000 shares of jpmorgan chase, currently trading at $64.75, 1,000 shares of walmart, currently trading at $63.10, and 2,500 shares of pfizer, currently trading at $31.50. the mutual fund has no liabilities and 20,000 shares outstanding held by investors. what is the nav of the fund? $16.92 $8.74 $11.52 $13.57 crisis may be turmoil and stress in only one area of a person's life, such as work, whereas it may not produce any stress in another person's life. Change the following sentences into the simple past tense.I drink coffee in the morning.ii.iii.iv.V.vi.vii.viii.ix.X.She works at a bank.My father drinks juiceMy sister lives abroad.She earns a living by writing stories.He wants to be an engineer.Mother cooks delicious pasta.The boys work hard to pass the test.She wants to leave.I don't know the answer.END OF AUGUST 2022 An investor puts $750 into an account. the account averages an annual growth rate of 8%. the investor adds no new money to the account. she decides she will keep the account until its value has at least tripled. which inequality can be used to represent the number of years, t, it will take for the account to triple in value? it doesn't let me unbubble the answer... Which phrase from The Innocents Abroad supports the answer to Question 9? In its first four years of operations ending December 31, 20X2, Alder, Inc.'s depreciation for income tax purposes exceeds its depreciation for financial-statement purposes. This temporary difference is expected to reverse in 20X3, 20X4, and 20X5. Alder's 2002 balance sheet should include in the implementation of myarraylist, which of the following are false? question 17 options: inside myarraylist, a regular array is used to store elements. size never reduces. if the current capacity equals to size, capacity is doubled when a new element is added to myarraylist size is not declared in myarraylist, but declared in myabstractlist as protected. capacity never reduces. g Refer to "Zlateh the Goat" in the anthology. Part AWhat inference can be made about Zlateh in "Zlateh the Goat" while she is in the haystack?She trusts Aaron to treat her well.She enjoys the cold and the snow.She resents being trapped in the haystack.She is afraid of the howling wind.Question 2Part B - Points depend on a correct response in Part A.Which excerpt from the story best supports the answer to Part A?Zlateh was not accustomed to being milked that way, but she did not resist.Zlateh, too, awoke, and when Aaron greeted her, she answered, "Maaaa.'Zlateh's bleating began to sound like crying."Zlateh slept all night and a good part of the day. sahali trading company has issued $100 million worth of long-term bonds at a fixed rate of 9%. sahali trading company then enters into an interest rate swap where it will pay libor and receive a fixed 8% on a notional principal of $100 million. after all these transactions are considered, sahali's cost of funds is . Which of the following best describes government rulein Champa between 1200 CE and 1450 CE?O The king was a theocratic ruler who bestowedblessings upon citizens in exchange for tribute.O The king was a figurehead, while feudal lordswielded actual power over the citizens.O The king was an elected ruler who administeredfinances and defense in a social contract.The king was an absolute ruler who expectedobedience from citizens in exchange for protection. is dna a base or acid