What did you think of the conclusion of the story? What do you think it means that Norma did not know her husband? What message does this present about our relationships and how well we know others?

(Buttons Buttons [search it up] )

Answers

Answer 1

Answer:

um

Explanation:

you need to show us the conclusion and story

Answer 2
Can we see like a paragraph of it

Related Questions

I WILL GIVE BRAINLIEST!!!! :) Choose one of the following questions to reflect on. Create a product that displays and explains your reflection.
° What happens when my perseverance doesn’t give me the outcome I wanted/expected?

° How do I feel when others accomplish a task without having to persevere, yet I have to persevere/struggle quite a bit and still fail or am not as successful? How do I feel about the other individual? Why?

Answers

I don’t know if you want me say which is right or creat a product so imma gonna do the reflection. When my perseverance doesn’t give me the outcome I wanted I expect it,Why would I expect it you probably ask well it’s because I learned that not everything goes your way and not to think everything will be the right outcome.Because it doesn’t always end up like that.

Can you give me reasons why we should stay at home and why it’s better than going back to school (it’s for a project). Plzzzzzzz helppp I need it right now or I might fail english class.
If you also have an evidence (why it’s important/ support the reason), can u help with that too, It’s ok if don’t.

Answers

Answer:

It s better to stay at home because the corona cases are going up because of the students and staff getting sick with corona

Explanation: I don t have prof just know it s true because of my school

A reason why we should stay at home instead of going to school is because we need to stay healthy from this virus. Why Because if we don’t we could all get sick and make the case is go up and have this pandemic for a lot longer than it needs to

2.3 Intensive and Reflexive Pronouns- Voyages in English 6th Grade

We bought ourselves some popcorn at the movies. Is that Reflexive or Intensive?

Answers

Reflexive because you are talking about yourself

Answer:

Explanation:

reflexive      Reflexive

^^^^                 ^^^^^^^^^^

/We/ bought /ourselves/ some popcorn at the movies.

ngf another jus incase .

ngf another jus incase .

Answers

Answer: ?

Explanation:

Answer:

Explanation:

your good you did it correct good job

Write a Halloween story using as many onomatopoeias as you can.

Answers

Answer:

some creepy and spooky onomatopoeias: BOOOOO GRRRRRRRR WOOOOOO AWOOOOOO etc.

You can use this sound and just come up with a few words
Write a Halloween story using as many onomatopoeias as you can.

PLEASE ANSWER FAST!!

We’re Going to Mars!

Human exploration of Mars is no longer the stuff of science fiction. The United States could very likely send its first delegation to the red planet in 2033. If SpaceX, a private company dedicated to space travel and exploration, has any say in it, humans will reach Mars as early as 2022. As amazing as this seems, studying Mars is expensive, difficult, and dangerous. The most important three questions are as follows: Why should we do it? How are we going to get there? How much will it cost?

Studying the evolution of other planets furthers our knowledge of our universe as well as our planet.

Today, Mars is too cold and the atmosphere is too thin for life to exist on the surface. However, evidence suggests that life may have existed in bacterial form billions of years ago. The planet must have been warm enough at one point to support life. Discovering what caused the change could help scientists better understand Earth’s climate. Also, studying sediments, rocks, and soils, as well as volcanoes and meteoroid impact sites, can help scientists study details of Earth’s evolution.

Exploring Mars could lead to colonization.

Settling other planets is the most attractive aspect of space exploration. It brings to mind entire galaxies filled with human outposts, discovering amazing landscapes and species, and possibly finding intelligent life similar to our own. Studying Mars is one of the first steps along the way. The benefits go well beyond the “wow” factor. Colonies would be able to reap raw materials—including electricity—on their planets and send them back to Earth. That’s right! Colonists could harvest the sun’s energy and send it to Earth in the form of electricity. Being able to farm renewable power will release humans from being too reliant on gas, coal, and nuclear energy.

Colonizing Mars goes beyond the practical rewards. It would be an important moment in the history of humanity, ranking up there with the discovery of “The New World” and the moon landing. It would require a lot of resources, money, and collaboration. Multiple countries could learn how to better our species. Some of the products we use every day were invented by NASA, including baby formula, water filtration, and cell phone cameras. The amount of technological innovation required for such an effort could benefit the world as well.

How will we do it?

NASA currently has plans to send a human mission to Mars by 2033. There are five phases, or steps.

Phase 0: has been going on since the main building of the International Space Station began in 1998. The experiments and collaboration with private space companies (such as SpaceX) are a major component of this phase.

Phase 1: requires that we build bigger and better spacecraft. This will transport the crew with all of the supplies it needs to survive.

Phase 2: Build a Deep Space Transport ​(DST)​ system. The ​DST​ system calls for creating vehicles that astronauts can live in during the two-year trip to Mars, as well as supply lines. This is a practice step of sorts. The system will be tested using missions to the moon.

Phase 3: Expand the ​DST​ system to Mars

Phase 4: Take a manned trip to the red planet.

If this sounds expensive, that’s because it is. Mars One, a private space exploration company whose mission is to establish a permanent human colony on Mars, estimates that it will cost $6 billion. SpaceX estimates that it will cost $10 billion per person. NASA’s costs are much higher. It thinks that such a mission would ultimately cost $1 trillion. Currently, NASA receives 0.5% of the national budget, or $22.629 billion, for all of its operations.

But don’t worry! Although the cost seems extremely high, Elon Musk, who owns SpaceX, thinks that the cost of moving to the moon will eventually be much less. Once everything is in place, the colonies are established, and deep space travel is normalized, someone could move to Mars for as little as $100,000.

“It gets to the point where almost anyone, if they saved up and this was their goal, could buy a ticket and move to Mars — and given that Mars would have a labor shortage for a long time, jobs would not be in short supply,” he said.

Question
In “We’re Going to Mars!” the author’s viewpoint is that travel to Mars is likely in the near future.

How is this viewpoint best conveyed in the text?

Responses

He lists the benefits of NASA exploring and colonizing Mars and other planets.

He emphasizes the impact colonizing Mars will have on humanity.

He describes the detailed plans and timelines for a NASA mission to Mars.

He argues that the cost of a human mission to Mars is expensive.

Answers

Based on the information provided in the passage, the viewpoint that travels to Mars is likely in the near future is best conveyed by the option:

He describes the detailed plans and timelines for a NASA mission to Mars.

The passage discusses NASA's plans and phases for sending a human mission to Mars by 2033, highlighting the steps involved in achieving this goal. This focus on the strategies and timelines indicates the author's belief in the feasibility and likelihood of traveling to Mars in the near future.

The best response that conveys the author's viewpoint in "We're Going to Mars!" is: He lists the benefits of NASA exploring and colonizing Mars and other planets. Thus, option A is the correct option.

Throughout the text, the author discusses the reasons why traveling to Mars is important and highlights the potential benefits of exploring and colonizing the planet. The author mentions how studying Mars can further our knowledge of the universe and our own planet, emphasizing the scientific and environmental implications.

The author also emphasizes the idea of colonization and how it can lead to practical rewards such as harvesting renewable energy and reducing reliance on traditional energy sources. By listing these benefits, the author supports the viewpoint that travel to Mars is likely in the near future and presents a positive perspective on the topic.

Thus, option A is the correct option.

Learn more about NASA here:

https://brainly.com/question/29890206

#SPJ4

As an 11-year-old, my response to losing Clemente was to put together an album of photos clipped from newspaper stories. Since then I've read books and numerous stories about him and also watched documentaries of his life.

I didn't think I would learn much more about Clemente on this visit, and yet a few days ago my father, now a retired physician, told me of the time in the late 1960s when the perennial All-Star came to his office.

Seeking treatment for the back trouble that dogged him for much of his career, Clemente sat among the other patients and patiently waited his turn. It was an ordinary gesture by an extraordinary man, one that made his legend just a bit bigger in my eyes.

—“Clemente's Impact Wanes in Puerto Rico
40 Years after His Death,” Jorge Ortiz

Based on the clues in the passage, why would Jorge Ortiz start and end his story in 2012?

Because it shows that many people still don’t believe Clemente is dead.
Because it shows that he knew more about Clemente when he was 11 years old.
Because it shows that Clemente’s memory has become less important to everyone.
Because it shows how much Clemente has influenced him and others since his death.

Answers

C, because of the fact that I took the test in Ed 2020.

Answer:

C

Explanation:

Ed 2020.

what leads the narrator (death) to believe Germans are very fond of pigs? in the book thief

Answers

Answer:I think it’s because they act like them and there very greedy.

Explanation:

Hope this helps XD

What word best describes the tone of the resolution in "Oasis: Africa"?

Question 5 options:

Challenging


Argumentative


Peaceful


Motivational

Answers

Answer:

the answer should be; motivational

SO WERE ARE YOU FROM TEXT
There it was. Originally. The word suggesting that she cannot validate her sense of belonging to this place. The implication being that her ‘exotic’ genetic makeup excludes her from her right to belong to this land.

A. she does not understand its meaning
B. it is the title of something she is reading
C. she is proud of her “exotic” identity
D. the word has a very powerful effect on her

Answers

The answer is D because the world excludes her

Will mark Brainliest!
Read the following sentence: I bought a bunch of roses.
Which has the same meaning as the italicized phrase, but a different connotation?
A.) A bouquet of daises
B.) Bunch of daffodils
C.) Bouquet of roses
D.) Bunch of flowers
Please help!!

Will mark Brainliest! Read the following sentence: I bought a bunch of roses.Which has the same meaning

Answers

Answer:

I would say C

Explanation:

bunch can be simmilar to bouquet, and im assuming they want to keep the roses.

Answer:

I would say it’s letter choice “C”

Pilgrims, searching for religious freedom and a new life, left England for America.

What type of phrase is searching for religious freedom and a new life?

Appositive
Fragment
Participial
Prepositional

Answers

D
just trust me or do research you’ll find it

Prepositional type of phrase is searching for religious freedom and a new life. Thus, its D.

What is Prepositional phrase?

Prepositional phrases are collections of words with prepositions in them. Prepositions are words that show the relationships between different parts of a sentence.

If you keep this in mind, you'll never have trouble recognizing prepositional phrases. A prepositional phrase is a collection of words that serves as a single unit of speech but lacks either a verb or a subject.

A preposition and a noun or a preposition and a pronoun are typically used in it. Prepositional expressions don't need to be simple.

Prepositional phrases can be spiced up by adding more words, such as adverbs or adjectives, in the same way that adding more ingredients to a sandwich dresses it up. A prepositional phrase is a sentence fragment made up of a single preposition and the subject it modifies.

Learn more about Prepositional phrase, here

https://brainly.com/question/17542837

#SPJ3

Who is the antagonist in a story?
A.
the main character
B.
the character who is a stand-in for the audience
C.
a supporting character who develops the main character
D.
a character who acts in opposition to the main character

Answers

Answer:

D

Explanation:

Answer:

its d.

Explanation:

a protagonist is the main character, often a hero/ a good character with good motives and the antagonist is the character who opposes the protagonist, often a villain. hope this helped

Animal Farm Chapter 9
Describe the living conditions for all of the animals, the pigs, and the dogs. How does Squealer justify their situation to the rest of the animals? Be specific.

Answers

Answer:

Animal Farm is a novel written by George Orwell that depicts a tale of farm animals who overthrow their human caretakers in pursuit of a society where animals govern themselves. As the story unfolds, readers see the living conditions on the farm deteriorate, especially for the common animals. The pigs and the dogs, however, seem to live rather comfortable lives, justifying their situation through propaganda disseminated by the eloquent Squealer.

Squealer uses propaganda to justify the unequal treatment of the animals and to convince them that it is necessary for the greater good of the farm.

In Chapter 9 of Animal Farm, the living conditions of the animals on the farm have deteriorated. The pigs, dogs, and other privileged animals have access to more resources and are treated better than the other animals. The pigs and dogs are better fed and live in better living quarters than the other animals.

Despite the substandard living conditions, Squealer justifies their situation to the rest of the animals. He claims that the pigs, dogs, and other privileged animals are working harder than everyone else. He says that they are doing so to ensure that the other animals on the farm have a better life. Squealer also says that the pigs are more intelligent than the other animals and therefore need more resources to maintain their intelligence.

Additionally, he argues that the pigs need a quiet environment to be able to think and plan properly. Squealer further claims that the dogs are essential for maintaining law and order on the farm and that they need to be kept healthy and strong in case of any threats to the farm.

For more such questions on Animal Farm

https://brainly.com/question/11752825

#SPJ8

HELP QUICKLY PLEASE
Q: Read the following excerpt from The Princess and the Goblin by George Macdonald. Then, answer the question that follows.

Perhaps you will wonder how the princess could tell that the old lady was an old lady, when I inform you that not only was she beautiful, but her skin was smooth and white. Her hair was combed back from her forehead and face, and hung loose far down and all over her back. That is not much like an old lady—is it? Ah! but it was white almost as snow. And although her face was so smooth, her eyes looked so wise that you could not have helped seeing she must be old. The princess, though she could not have told you why, did think her very old indeed—quite fifty, she said to herself.

Which narrative technique is most evident in this passage?

A. Dialogue
B. Flashback
C. Foreshadowing
D. Sensory details

Answers

Answer:

mm this is a hard one I would go with sensory details though that makes the most sense

Explanation: it explains how her face was smooth eyes wise those are details hope this helps!

sensory details, this is because of how in depth the actual dialogue and except is

Explain the irony of Jackon’s father asking, “Now what type of parent would I be if I allowed my kid to eat cookies for breakfast?” (“Jackson and the Cookie Jar”)

Answers

Answer:

Verbal Irony

Explanation:

i hope it good :)

Answer:
Verbal trony

Have a nice evening

Explain the author’s purpose in using the word “speech” twice in the long title, yet making the poem itself very brief.

"Speech to the Young: Speech to the Progress-Toward"

"Say to them,
say to the down-keepers,
the sun-slappers,
the self-soilers,

the harmony-hushers,
Even if you are not ready for day
it cannot always be night.”
You will be right.
For that is the hard home-run.

Live not for battles won.
Live not for the-end-of-the-song.
Live in the along."

Answers

Answer: Using the word "speech" twice in the title, can grab the reader's attention to the specific point that is made in the brief poem.

Explanation:

Authors like to use repetition in a poem so that the main point of the text can be emphasized, and have a deeper meaning. It also is a persuasive technique. So, since the poem "Speech to the Young: Speech to the Progress-Toward" has a repetition of the word twice, at first glance, the person who is reading kind of has an idea of what the poem is talking about before they read it fully.

Answer: It is telling the reader what the poem is about.

Explanation:

Repeating words in a poem shows the main idea of it (What it's about).

So it is giving the reader a hint on what the poem is about.

Hope everything goes well!

Does anyone know what is a subject?

Answers

Answer:

a person or thing that is being discussed, described, or dealt with.

It’s like a topic it’s about something weather that be a person place or thing like the other person said

Who was Imhotep and how does he relate to black and brown mathematicians and scientists?


Please answer ASAP!!

Answers

Imhotep was an Egyptian polymath best known as the architect of King Djoser's Step Pyramid at Saqqara. His name means "He Who Comes in Peace" and he is the only Egyptian besides Amenhotep to be fully deified.

A positive adjective and adverb make a statement about a person, place or thing. Write a sentence that uses the superlative form.

Answers

• I can’t find my most comfortable jeans.
• The runt of the litter is the smallest.
• She is the smartest girl in our class.
• This is the most interesting book I have every read.

Answer:

Marcus is the tallest boy in the class

This book is the longest one that I have ever read

Joseph seems to be the most excited child at the party.

rabbit is always fastest than turtle

Explanation:

We have so much in common
We argue all the time
You always say I'm wrong

Answers

Answer:

facts facts  I complety understand the question you are asking

Explanation:

Is the following statement logical? Please choose if the statement below is sound or not sound.

My Labrador Sam is such an easy pet to have around the house; therefore, all dogs should be good pets.

Sound
Not Sound

Answers

Answer:

The answer is not sound

Explanation:

because you cannot assume all pets are good to have if your pet is good to have.

Answer: Not Sound.

Reason why: The reason why the answer is not sound is because you are saying that because your dog is an easy pet to have around the house, does not mean all dogs are easy around the house.

Michael went to the library to research his topic, use the computers, and study for a test.

The purpose of the commas in this sentence is to.....
1. introduce a list of items.
2. indicate an interruption.
3. set off extra information.
4. separate items in a series.

Answers

4. separate items in a series
it’s number 4 separate items in a series

I need help ASAP I have forty missing assignments and two weeks left in school so I have finish them quickly
Refer to Where Is Niagara Falls? for a complete version of this text.

Which details from Chapter 4 best explain how Blondin's and Farini's acts affect business at the falls?

Select the two correct answers. (Also this is a elementary question not a middle school one because im still in fifth grade)

I need help ASAP I have forty missing assignments and two weeks left in school so I have finish them

Answers

Answer is the last one I think
It is obvious it is not 1 or 3. I’d say it is 2 because they story focuses on this dynamic a lot from chapter 3-6. There’s an argument for 4 but you can literally look anywhere is chapter 4 and prove it unlike answer 4.

Read the excerpts from the two articles on sea otters.

Article A

Sea otters live in the chilly Northern Pacific Ocean and spend almost all their lives in the water. They sleep, hunt, groom, mate, and give birth in the ocean, where they float on their backs on the water's surface. Adult sea otters spend more than a third of their day grooming their fur. This isn't for vanity; it's for survival. Unlike most sea mammals, sea otters do not have an inner layer of fat to protect them from the cold water. These creatures rely on their dense fur to protect them from the low temperatures. Sea otters have one of the thickest furs in all of the animal kingdom. An adult sea otter's coat can contain up to 1 billion individual hairs! These hairs form a protective, waterproof layer, which traps air and provides insulation. It is crucial that a sea otter's fur is kept clean to maintain this insulating layer between the water and their skin.

Article B

Oil spills from off-shore drilling and shipping are also an immense threat to sea otters. Sea otters are dependent on their thick fur to keep them warm. Its unique structure traps air that insulates their bodies from the cold water. When an otter's fur is covered in oil, it can no longer keep the otter warm. This can cause hypothermia and even death. If the otter tries to clean its fur, it will ingest the oil, which is poisonous. In 1989, the Exxon Valdez hit a reef in Alaska. The ship spilled over ten million gallons of oil into the ocean. The U.S. Fish and Wildlife Service believes that anywhere from 4,000 to 10,000 otters died due to this oil spill.

How are the authors' points of view different in these excerpts?

Article A focuses on the importance of the sea otter grooming its fur, but Article B shows that the sea otter's grooming habits endanger it when the water is not clean.
Article A explains that adult sea otters spend more than a third of their day grooming, but in Article B, the author explains that adults spend most of their day caring for their young.
Article A highlights the different reasons the sea otter's fur must be clean, and Article B highlights the actual process sea otters use to keep their thick coats clean and healthy.
Article A focuses on how the sea otter's fur can harm the animal, while Article B focuses on how the sea otter's fur can protect it from oil spills and other water pollution.

Answers

Answer:

Article A focuses on the importance of the sea otter grooming its fur, but Article B shows that the sea otter's grooming habits endanger it when the water is not clean.

Explanation:

Adult sea otters spend more than a third of their day grooming their fur. This isn't for vanity; it's for survival.

When an otter's fur is covered in oil, it can no longer keep the otter warm. This can cause hypothermia and even death.

Answer:

Article A focuses on the importance of the sea otter grooming its fur, but Article B shows that the sea otter's grooming habits endanger it when the water is not clean.

Explanation:

I just took the test called: 12.04 point of view : Rights

write as many adjectives and descriptive phrases as you can about crusty in chapter 17 in Lightning Theif

Answers

Answer

i think it is about 56 to 94

Explanation:

Answer:

Explanation:

Here are some adjectives and descriptive phrases that describe Crusty from chapter 17 in Lightning Thief:

- Bristly eyebrows

- Wiry hair

- Gruff voice

- Crooked nose

- Scraggly beard

- Rough hands

- Scratched arms

- Tattered clothing

- Dingy coat

- Pungent aroma

- Weathered skin

- Squinty eyes

- Shaggy mane

- Unkempt appearance

- Dirty fingernails

write a hook for persuasive essay. the issue: is the outsiders relevant today?

Answers

if yes:

Now you may see why the outsiders is active and relevant in the world today that every reader deserves to view.

——-

if no:

There are several strong reasons as to why the outsiders is not relevant today that all readers must see.

Is it possible for a book written over 50 years ago to still have the power to captivate and resonate with readers in today's society? When it comes to S.E. Hinton's 'The Outsiders', the answer is a resounding yes. This classic novel, with its raw depiction of teenage struggles, societal divides and the bond of brotherhood, is as relevant today as it was during its initial publication. Hinton's thought-provoking themes still serve as a reflection of our society and continue to capture the hearts and minds of readers, leaving a lasting impact on future generations.


Every house should have a dog. They are cute, loyal and will protect your house. What is the author's purpose?

A)Persuade
B)Inform
C)Entertain

Answers

It’s to Persuade the reader to by a dog because it lists the traits of them and why you should have a puppy.

PLEASE PLEASE HELP ASAP, DUE TONIGHT!

Answers

Answer:

Title of Novel or Short Story: "Esperanza Rising" by Pam Muñoz Ryan

Setting: The story takes place in the 1930s in both Mexico and California. The setting of the Great Depression heavily influences the plot and characters.

Protagonist: Esperanza is a young, privileged girl from a wealthy family in Mexico who is forced to flee to California after her father's death. She faces numerous challenges as she adjusts to a new life as a migrant farm worker.

Quotation: "Esperanza was a girl who loved the stories Papa told. They were stories of magic and beauty, of the country of Mexico and the different regions where Mama and Papa had grown up" (page 3).

Conflict: The main conflict in the story is external and comes from the challenges Esperanza and her family face as migrant farm workers during the Great Depression. They encounter racism, difficult working conditions, and other obstacles that threaten their safety and well-being.

Quotation: "Esperanza felt as if she were looking at the ocean, which she had seen only once and which scared her with its immensity" (page 31).

Antagonist: The antagonist in the story is the difficult living and working conditions that Esperanza and her family face as migrant farm workers. Additionally, the racism and discrimination they encounter from other workers and locals add to their struggles.

Quotation: "The bosses had made their point. The Mexican workers needed the white workers more than the white workers needed them" (page 108).

Backstory: An important piece of the backstory is that Esperanza's father was a wealthy landowner in Mexico, and their family had many luxuries and privileges. However, his death and the Mexican Revolution forced them to flee to the United States and start a new life.

Quotation: "Mama never talked about the revolution. She said it made her sad" (page 6).

Plot Development: Early in the story, Esperanza and her family experience tragedy when her father is killed by bandits. This event sets off a chain of events that forces them to flee to the United States and adjust to a completely new way of life.

Quotation: "Esperanza didn't know how they would go on without Papa. She couldn't imagine how they would live without his protection" (page 12).

How is the simile used in this sentence?

How is the simile used in this sentence?

Answers

Answer:

D.

Explanation:

It's implying that they were identical twins, therefore it looked as if Aaron was staring back at him from the mirror.

Answer: I’m pretty sure it’s D

Explanation:

Other Questions
a substance that cannot be separated into simpler substances by physical or chemical means is a (n) one package of raspberries cost 3$. how many packages of raspberries an you buy for 18$ What new invention allowed the British to effectively defend against German air attacks? Can someone answer this correctly please and thank you :D Recruitment sources are unlimited; therefore, an organization must decide how to reach the best sources of potential employees. Sources of recruitment include: internal and external sources, direct applicants, referrals, advertisements, electronic recruiting, public and private employment agencies, and colleges and universities. Evaluating the quality of recruiting sources can be done by compiling yield ratios that express the percentage of applicants who successfully move from one stage of the recruitment and selection process to another. In this exercise, please read the mini-case and answer the questions that follow. A large Midwestern university is opening a regional branch about an hour away from its main campus. Labor projections suggest that the company will need to hire about 200 new employees to fill cleaning, maintenance, security, and cafeteria entry-level positions. Because of traffic and bad winter weather, it is unlikely that many of the university's current staff will want to transfer to the regional branch. Most of the openings are for hands-on, manual labor jobs that do not require a college education, extensive computer skills, or office experience. The university would like to minimize the cost of its recruiting efforts.1. Which of the following recruitment sources should the university use to fill its 200 positions?a. Newspaper advertisingb. Colleges and universitiesc. Electronic recruiting2. Which of the following recruitment sources should the university avoid using to hire for its entry-level positions?a. Referralsb. Headhuntersc. External sources Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X What is a good sport or activity to do in high school that looks good on your college application? true or false 4. If the area of a rectangle is 6 m2, then the dimensions must be 2 meters by 3 meters. What about the state alabama? 2. For which value of x is therelation not a function?{(5,2),(x, 1),(8,6),(9,3)}A) 1C) 4B) 9D) 6 Please solve this questionX P(x) XP(x) (x-M) P(x) 0 0.2 ___ ___1 ___ ___ ___2 0,25 ___ ___3 0,4 ___ ___a. Expected value b. Vorince c. Standard deviation X Jaica Parker would like to have $46,000 to buy a new car in 9 year. To accumulate $ 46,000 in 9 year, how much hould he invet monthly in a inking fund with 9 % interet compounded monthly? A car travels at a constant speed of 27.6 m/s around a circular track that has a radius of 195 m. What acceleration does it experience? in a conductor, what is the material through which it is difficult to conduct an electric current called? Wardell Company purchased a mini computer on January 1,2019 , at a cost of $36,600. The computer has been depreciated using the straight-line method over an estimated five-year useful life with an estimated residual value of $3,600. On January 1, 2021, the estimate of useful life was changed to a total of 10 years, and the estimate of residual value was changed to $600. Required: . Prepare the appropriate adjusting entry for depreciation in 2021 to reflect the revised estimate. (If no entry is required for a ransaction/event, select "No journal entry required" in the first account field.) 2. Prepare the appropriate adjusting entry for depreciation in 2021 to reflect the revised estimate, assuming that the company uses the sum-of-the-years'-digits method instead of the straight-line method. (If no entry is required for a transaction/event, select "No journal entry required" in the first account field. Do not round intermediate calculations and round your final answers to nearest whole dollar.)c A municipal dealer purchases securities. The securities are delivered on settlement date and the dealer finds that the wrong securities were delivered. The municipal dealer refuses the delivery of the securities by what action? Task 6-6.06 1. Let (X, Y) has the two dimensional Gaussian distribution with parameters: vector of expectations 14= (EX, EY)= (1,-1) and covariance matrix c-[ Cov(X, X) Cov(X, Y) Cov(Y, X) Cov(Y, Y) * Emma has a coupon for $5.25 off a frame that normally costs $15.00. What percent discount did she receive on the frame? Show your work in arriving at your answer. What is cbaalep unscrambled Find the circumstance of each circle you 3.14 or 22/7 and round to the nearest hundredth if necessaryAnswer number 11 pls