What do you mean by public policy?

Answers

Answer 1

A system of rules, regulations, courses of action, and financial priorities involving a specific subject that have been established by a governmental body or its representatives is known as public policy.

Informing the public on healthy lifestyle choices, such as what they eat, how much exercise they get, and the risks of smoking, are some instances of public policy. Public policy, which is governed by a notion and frequently carried out by programs, is an institutionalized plan or a decided set of features like laws, rules, guidelines, and activities to solve or address pertinent and real-world problems. The entire range of governmental laws, regulations, court rulings, and local ordinances is best characterized as public policy. Government now has an impact on every part of our life. The implementation of public policies affects everyone. by municipal, state, and federal authorities. Public policy, organizational policy, functional policy, and specific policy are the four different categories of policies. A path of action put forth by a group or a person is referred to as a policy. Following the conventional paradigm, the public policy making process has five basic steps: agenda setting, policy formulation, decision-making, policy execution, and policy evaluation.

Learn more about policy here :

https://brainly.com/question/25838770

#SPJ4


Related Questions

What did Justice Ginsburg mean when she described the Supreme Court as “reactionary?”

Answers

Due to the strong enforcement of traditional gender roles in the US at the time, women were historically discouraged from pursuing higher education. She intended the change to benefit some people.

Who was Ruth Bader Ginsburg ?

Ruth Bader Ginsburg was one of just 9 women accepted into Harvard Law School when she was younger. To put things into perspective, Harvard at that time welcomed about 500 new students yearly.

It was very difficult to get high paid jobs at the time, even for highly educated women. The majority of businesses simply hire women for secretarial positions without giving them the option to advance to managerial positions.

However, Ruth Bader Ginsburg eventually rose to the position of supreme court justice.

Learn more about Justice Ginsburg here

https://brainly.com/question/19556210

# SPJ 3

my last made me feel like i would never try again but when i saw you ....​

Answers

Answer:

i felt something i never felt come closer ill give u all my love if u treat me right baby ill give u everything

Explanation:

talk to me, i need to hear you need me like i need you…fall for me, i wanna know you feel how i feel for you, love…

On April 15, a seller entered into a valid written agreement to sell her home to a buyer for $175,000. The provisions of the agreement provided that closing would be at the buyer's attorney's office on May 15, and that the seller would deliver to the buyer marketable title, free and clear of all encumbrances. On the date of closing, the seller offered to the buyer the deed to the house, but the buyer refused to go ahead with the purchase because his attorney told him that a contractor who had done work on the house had recorded a lis pendens on May 1 against the property regarding a $10,000 contract dispute he had with the seller. The seller indicated that she was unaware of the lien, but that she was willing to go ahead with the sale and set aside funds from the purchase price to cover the contractor's claim until the dispute was resolved. The buyer still refused to proceed, stating that the seller had breached the contract. If the seller brings an action against the buyer for specific performance, what is the probable result?

A. The buyer prevails, because the title to the property was not marketable as of the date of closing.B. The buyer prevails, because an encumbrance was on the title as of the date of closing that was subject to litigation.C. The seller prevails, because under the doctrine of equitable conversion, the buyer was the owner of the property when the lis pendens was recorded, and therefore it was invalid.D. The seller prevails, because an implied term of their contract was that she could use the proceeds to clear any encumbrance on the title.

Answers

The buyer prevails, because an encumbrance was on the title as of the date of closing that was subject to litigation. Option (B)

Specific performance is an order given by a court that compels a party to follow through on the terms of a contractual commitment. A seller can request specific performance if the buyer has failed to follow through on the terms of a sales agreement.

Lis Pendens: A Lis pendens is a notice filed with the county recorder's office indicating that a property is the subject of a lawsuit. A Lis pendens notifies potential buyers or lenders that the property's title is in question and may be transferred or encumbered only subject to the outcome of the pending lawsuit.

In the given scenario, the buyer refused to go ahead with the purchase because his attorney told him that a contractor who had done work on the house had recorded a Lis pendens on May 1 against the property regarding a $10,000 contract dispute he had with the seller. On the date of closing, the seller offered to the buyer the deed to the house, but the buyer refused to go ahead with the purchase because his attorney told him that a contractor who had done work on the house had recorded a Lis pendens on May 1 against the property regarding a $10,000 contract dispute he had with the seller. The seller indicated that she was unaware of the lien, but that she was willing to go ahead with the sale and set aside funds from the purchase price to cover the contractor's claim until the dispute was resolved. The buyer still refused to proceed, stating that the seller had breached the contract. If the seller brings an action against the buyer for specific performance, the probable result will be the buyer prevails because an encumbrance was on the title as of the date of closing that was subject to litigation.

Learn more about Litigation

https://brainly.com/question/15284945

#SPJ11

The probable result of the seller bringing an action against the buyer for specific performance is that the buyer prevails because the title to the property was not marketable as of the date of closing.
In this scenario, the buyer refused to proceed with the purchase because a lis pendens had been recorded against the property regarding a $10,000 contract dispute. The seller was willing to set aside funds to cover the contractor's claim until the dispute was resolved, but the buyer still refused to proceed. The buyer's refusal to proceed with the purchase is justified because the lis pendens create an encumbrance on the title. Marketable title, free and clear of all encumbrances, was a provision of the agreement.
To know more about lis pendens, visit

https://brainly.com/question/33377801

#SPJ11

The English common law writ ( also adopted in the U.S) that allowed challenges to the legality of custody or imprisonment was the writ of
A. certiorari
B. habeas corpus
C. mandamus
D. pro hac vice

Answers

One of these writs is the writ of B. habeas corpus, which plays a significant role in protecting individual freedom and challenging the legality of custody or imprisonment.

The English common law writ system is a set of legal procedures that have been adopted and used in both England and the United States.

The writ of habeas corpus is a legal tool that allows individuals to challenge their detention or imprisonment by a public authority, such as the government or the police.

This writ requires the authorities to present the individual to a court, where they must justify the reasons for the detention. If the court finds that the detention is not lawful, the individual must be released.

The writ of habeas corpus is considered one of the most important legal protections for individual freedom and is widely recognized as a cornerstone of the English common law system.

It has been used for centuries to challenge the legitimacy of imprisonment and ensure that individuals are not held in custody without a lawful basis. The writ of habeas corpus is a powerful tool for protecting individual rights and ensuring that the government and other public authorities are held accountable for their actions.

To know more about English common law writ refer here:

https://brainly.com/question/30479173#

#SPJ11

If I was a reporter in the country of Washington D.C and the President sent the Secret Service and they told me that I cannot report anything about the president anymore. What amendment is the government infringing on (what amendment protects me from that)?

Answers

Answer:

The First Amendment

Explanation:

In the United States Constitution, the First Amendment state that "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the PRESS; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances."

Thus, Freedom of the PRESS is part of the United States First Amendment, that protects the right of individuals to acquire and disseminate data or viewpoints without government censorship or concern of penalty.

Hence, in this case, the amendment the government is infringing on is THE FIRST AMENDMENT

One of the "Four P's" is to project a
professional image. Which of the following
items is NOT a key component of a
customer friendly image?

a. Personal appearance
b. Fancy jewelry
c. Eye contact
d. Smile

Answers

The correct answer is B because fancy jewelry has nothing to do with a customer friendly image

The Magna Carta was the first document to do which of the following? A. limit government’s power B. require taxes from citizens C. gave president's veto power D. guarantee women equal rights

Answers

Answer:

A

Explanation:

it put into writing the principle that the king and his government was not above the law.

Which civic responsibilities are required by law ?

Answers

Voting and paying taxes are required civic responsibilities.

What are two obligatory civic responsibilities?

Two civic responsibilities that are required by law in many countries, including the United States, are voting and paying taxes.

These responsibilities are considered fundamental to the functioning of a democratic society and the maintenance of government operations.

Voting is a crucial civic duty as it allows citizens to participate in the democratic process by electing their representatives and expressing their preferences on important issues.

It ensures that the government reflects the will of the people and promotes accountable governance.

Paying taxes is another essential civic responsibility. Taxes provide the government with the necessary resources to fund public services and infrastructure, such as education, healthcare, transportation, and defense.

By fulfilling their tax obligations, citizens contribute to the functioning of government and the well-being of society as a whole.

While these two responsibilities are required by law, there are also other voluntary civic duties that individuals can undertake, such as community service, jury duty, and obeying the law. These actions contribute to the betterment of society and promote a sense of civic engagement and responsibility.

Learn more about civic responsibilities

brainly.com/question/32830897

#SPJ11

Actual performance is equal to tender of performance

Answers

A consultant was alleged to be in material breach of a consultancy contract for refusing to supply his services. He responded to a material breach notice by stating that he was willing to perform. However, the Court of Appeal held that this was insufficient to remedy the breach (Bains v Arunvill Capital Limited).(According to the court, actual performance, rather than an indication of a willingness to perform, is required to remedy a material breach of contract.

Different between citizen and alien

Answers

Explanation:

A citizen is a permanent resident of a state, while an alien is a temporary resident, who comes for a specific duration of time as a tourist or on diplomatic assignment

a legal document signed by the patient dealing with the types and extent of medical treatment the person wishes to have during the process of dying is called a (n)

Answers

The legal document signed by a patient that outlines their wishes regarding medical treatment during the process of dying is commonly known as a living will or advance directive.

This document allows individuals to specify their preferences for end-of-life care, such as whether they want to receive life-sustaining treatment or be kept comfortable with pain management. It also often includes instructions for healthcare providers and family members regarding the use of artificial nutrition and hydration, resuscitation, and other medical interventions. It's important to note that a living will can only be enacted if the individual is unable to communicate their wishes themselves, so it's important to have conversations with loved ones and healthcare providers about end-of-life care preferences in advance.

To know more about  advance directive visit:

https://brainly.com/question/30410648

#SPJ11

what likely problems soldiers living in trenches may have to endure

Answers

Soldiers living in trenches during wartime are exposed to a multitude of problems that can have a severe impact on their physical and mental health.

Trenches were constructed as a means of protection from enemy fire, but they also created a hazardous living environment for soldiers. Some of the likely problems that soldiers may have to endure in trenches include:

1. Exposure to extreme weather conditions: Trenches were often located in areas with harsh weather conditions, and soldiers were exposed to extreme heat or cold, rain, snow, and mud. This exposure could lead to frostbite, hypothermia, or heat stroke.
2. Poor hygiene: The lack of running water, sanitation facilities, and overcrowding meant that soldiers living in trenches were exposed to diseases such as dysentery, typhoid fever, and trench foot. Inadequate hygiene could also lead to infestations of lice, rats, and other vermin.
3. Mental stress: The constant noise of gunfire, explosions, and the risk of being attacked at any moment can cause significant psychological stress on soldiers. This can lead to mental health issues such as anxiety, depression, and post-traumatic stress disorder (PTSD).
4. Lack of sleep: Soldiers living in trenches often had to stay alert for long periods, which meant that they were unable to get adequate sleep. This could lead to exhaustion, irritability, and a reduced ability to function effectively in battle.
5. Limited access to food and water: Soldiers living in trenches had limited access to food and water, which meant that they often suffered from malnutrition and dehydration.

Overall, soldiers living in trenches during wartime faced a wide range of problems that could have a severe impact on their physical and mental health.

Know more about trenches here:

https://brainly.com/question/1055859

#SPJ11

Which term is synonymous with natural rights, according to Enlightenment philosophers?
legal rights
divine richt
positive rights
universal rights

Answers

Legal rights......I’m pretty sure

Answer: Universal rights

Explanation:

What 2 types of courts do most states have?

Answers

There are two different types of courts: the trial court and the appellate court, both at the federal and state levels.

What types of courts exist in most states?

The main responsibility of the trial court is to settle cases by gathering the relevant information and using the law to establish who is in the right.

India's judicial system consists of the Supreme Court of India, High Courts, and other courts at the district, municipal, and village levels.

The United States' Constitution is the country's highest law. It establishes a federal system of governance in which state and federal governments each have equal authority. Federalism allows for separate court systems for the federal government and each state government.

There must be fundamental divisions between the criminal and civil justice systems, general and specialised courts, and appellate and trial courts.

To learn more about court refer to:

https://brainly.com/question/1232569

#SPJ4

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

3. A promotional.permit allows you to:
A. Drive around and offer samples of alcoholic beverages from your car
B. Offer a discounted price on alcoholic beverages
C. Promote the sale of certain alcoholic beverages by offering in-store samples, demonstrations, and
promotions
D. None of the above

Answers

the answer to the question is c promote sake of certain alcoholic beverages by offering in store samples demonstrations and promotions

a company developed a software package with an unexpected side effect. the company was sued in court and paid damages, but did not admit to fault. which of the following terms best describes this situation?

Answers

The term that best describes the situation in which a company developed a software package with an unexpected side effect is "product liability.

"Product liability is a legal term that refers to the responsibility of manufacturers and sellers for injuries caused by defective products. The fact that the company was sued in court and paid damages indicates that the unexpected side effect of the software package caused harm to someone, which led to a lawsuit. The company may not have admitted to fault because they may not have intentionally caused the side effect, but they are still responsible for the damage caused by their product.

Learn more about product liability here:

https://brainly.com/question/30805836

#SPJ11

in deciding whether a contract was formed, the courts look to the subjective intent of the parties. a. true b. false

Answers

The courts consider the subjective intention of the parties when determining whether or not a contract was formed. This statement is False.

whether a contract exists based on a subjective or objective standard?

The objective standard test governs terms and conditions, which asks if a reasonable person observing the interaction would surmise that an acceptance and an offer had occurred.

Which of the four considerations is taken into account by courts in evaluating whether an argument is a term or solely a depiction?

The rule of parol evidence

A court's starting point in deciding whether a written term is a term or a misrepresentation is that it is a term and the only term.

To know more about parol evidence click here brainly.com/question/29679663

#SPJ4

How many calendar days does a new employee have to complete the RBS training program

Answers

Any on-premise alcohol server and manager must be certified by an accredited RBS training provider and pass an ABC exam within 60 calendar days from the first date of employment. The RBS exam is currently available in English, Spanish, Korean, Chinese, Vietnamese, Tagalog, Hindi, and Punjabi.

Any on-premise alcohol server and manager must be certified by an accredited RBS training provider and pass an ABC exam within 60 calendar days from the first date of employment. The RBS exam is currently available in English, Spanish, Korean, Chinese, Vietnamese, Tagalog, Hindi, and Punjabi.

Which of these is NOT a reason why a dirt or gravel road can be
dangerous?

A. Your tires are more likely to be punctured

B. There can be gravel or dust kicked back onto your windshield

C. It means you are off the GPS network which is dangerous

D. It’s most likely for your vehicle to lose traction

Answers

Answer:

B. There can be gravel or dust kicked back onto your windshield

Explanation:

Losing the track of a GPS network is not a dangerous for driving on a gravel road or dirt.

What is a gravel road?

Gravel road is a road, the upper surface of which is covered with gravel and small crushed stones. There is risk of tires getting punctured, or vehicle to lose traction while driving on such roads.

Hence, option C holds true regarding a gravel road.

Learn more about a gravel road here:

https://brainly.com/question/5215737

#SPJ2

Which of these is NOT a reason why a dirt or gravel road can bedangerous?A. Your tires are more likely

which taxpayer would not be considered a material participant of an activity?

Answers

A taxpayer who would not be considered a material participant of an activity is: one who fails to meet the specific criteria established by the IRS for material participation.

Material participation is a key factor in determining a taxpayer's ability to deduct losses from passive activities against non-passive income.

To be considered a material participant, a taxpayer must meet one of the seven tests outlined in the Internal Revenue Code Section 469. These tests involve the level of involvement and time spent on the activity, such as spending more than 500 hours annually on the activity or being involved substantially more than any other individual.

A non-material participant would typically be a passive investor or someone who has minimal involvement in the day-to-day management or decision-making of the activity.

This type of taxpayer would not be able to deduct passive losses against non-passive income, which can impact their overall tax liability. It is essential for taxpayers to understand their participation status, as it affects their ability to claim deductions and manage their tax obligations effectively.

In summary, a taxpayer who does not meet the criteria for material participation, as defined by the IRS, would not be considered a material participant of an activity. This classification impacts their tax deductions and overall tax liability.

To know more about IRS, refer here:

https://brainly.com/question/30401300#

#SPJ11

The term amicus curiae means: Select one: a. friendly cure or the amicable resolution to a mediated dispute. b. friend of the court and refers to briefs filed by third parties interested in the outcome of a certain appeal. c. small couriers or the briefs, originally used by foot messengers, which are used to communicate between lawyers and the courts. d. the name for the conductor of an arbitration, a position originally filled by medieval clergy.

Answers

Answer:

Friend of the court and refers to briefs filed by third parties interested in the outcome of a certain appeal

Explanation:

Literally translated from Latin to English, amicus curiae means "friend of the senate"

3 reasons why someone should not create their own laws​

Answers

Answer: Poeple are bias, there going to creat something that benefit ls them and not everyone, also if one person creates their own law everyone else will want to do it to which would destroyed our economy

Explanation:

The Supreme Court has ruled that young peoples First Amendment rights may be limited

Answers

Answer:

True

Explanation:

discuss the rule of law as a democratic principle which supports a democracy under the following headings its importance

Answers

The ways that the rule of law supports democracy include:

Increasing human dignity and respectAllowing commerce and business to flourish Fair and equal application of the law sustains economic and social growthEnsures religious freedom and free speech.

What is the rule of law?

The Rule of Law is based on set rules than arbitrary decisions.  As a democratic principle, it recognizes that no person operates above the laws of the land.

This democratic rule follows from the universal idea that law (truth) is based upon discoverable but unimaginable fundamental principles necessary for the protection of undeniable divine rights.

Thus, the ways that the rule of law supports democracy are numerous.

Learn more about the rule of law at https://brainly.com/question/820417

IM GIVING BRAINLIEST. who is the right person to vote for

Answers

Answer:

Your own decision!

Explanation:

Don't let other people influence choices that are totally up to you to choose

an exception to the statute of frauds' rule requiring a written contract for the sale of goods in excess of $500, if the goods are and the other party has started performance, the oral contract may be enforced.

Answers

True, An oral contract may be enforced if the other party has begun performing, which is an exception to the statute of frauds rule requiring a written contract for the sale of goods worth more than $500.

(1) A contract for the sale of products is one in which the seller transfers or agrees to transfer the buyer's ownership of the goods in exchange for payment, or the price. There could be a sale agreement between two co-owners. (2) A selling agreement may be either unconditional or conditional. You might have an apple orchard with apples, for instance. You consent to selling a buyer 1000 apples once they are ripe. Although the sale of these commodities must take place in the future, the agreement has already been reached and the goods have been identified. The Act, which regulates legal agreements between parties, guarantees both that their legal rights are upheld while exchanging property and that the goods' quality and price are as promised.

Learn more about sale of goods here

https://brainly.com/question/14055207

#SPJ4

why is severing on a jury important?​

Answers

Answer:

Explanation:

Jurors perform a vital role in the American system of justice. ... Jury service is a high duty of citizenship. Jurors aid in the maintenance of law and order and uphold justice among their fellow citizens. Their greatest reward is the knowledge that they have discharged this duty faithfully, honorably, and well.

Jurors perform a vital role in the American system of justice. ... Jury service is a high duty of citizenship. Jurors aid in the maintenance of law and order and uphold justice among their fellow citizens. Their greatest reward is the knowledge that they have discharged this duty faithfully, honorably, and well.

What is the 14 Day Rule:

Answers

Answer:

Explanation:

The '14-day law' is fundamental to the administration of human embryo science. While applied in various forms in different nations, nature remains the same everywhere the cap applies: it stipulates that human embryos can not be produced in vitro for more than 14 days after fertilization, for any reason.

Should it be more difficult or easier to impeach public officials and why

Answers

Answer:

it indeed should be harder.

Explanation:

So every people can be sure who they need to choose and vote

Other Questions
What are some of the words used to describe the house of usher? What would the weight of the Labrador be in kilograms?A. 4 kilogramsB. 88 kilogramsC. 40 kilogramsD. 8 kilogramsWILL MARK BRAINLY NO BOTS In the lliad one reason hector can be considered an epic hero is because he What happens during a stroke? How do you find the missing side of a 90 degree triangle? The familiar brown color of human feces comes primarily from the orange-colored product of red blood cell breakdown that has been secreted in the bile and has become brown as it travels through the intestines. Which product contributes to this color Which of the following is a vendor of popular anti-virus software?a. Microsoftb. Symantecc. McDonald'sd. Bayer Select a word which means -A 1 pointstate of great disturbance,confusion, or uncertainty.O TurmoilO ComposureO HurdleO Vigorous What would be the advantage of changing this excerpt to Averys first-person point of view?A. to compare Rosa Parks and Irene Morgan in more detailB. to add more facts about both Irene Morgan and Rosa ParksC. to get more background on why Maritza treats Avery this wayD. to learn more about how Avery feels about Maritzas treatment of her why can you not take blood pressure on the side of a mastectomy An IP subnetting design effort is under way at a company. So far, the senior engineer has decided to use Class B network 172.23.0.0. The design calls for 100 subnets, with the largest subnet needing 500 hosts. Management requires that the design accommodate 50 percent growth in the number of subnets and the size of the largest subnet. The requirements also state that a single mask must be used throughout the Class B network. How many masks meet the requirements What are the various product line decision, and when do marketing managers make each of these decisions? What is the meaning of product mix, width, depth, and length For the following equilibrium, what will occur if the vessel contracts: C(s) H2O(g)CO(g) H2(g)Select the correct answer below: a. shift right b. shift left c. no change d. impossible to predict Carrie has listed the following numbers in order from least to greatest.StartFraction 2 Over 6 EndFraction, one-half, StartFraction 4 Over 5 EndFractionWhich number can she add to the beginning of her list and still keep the list in order?StartFraction 1 Over 8 EndFractionStartFraction 2 Over 5 EndFractionStartFraction 5 Over 5 EndFractionThree-halves If, in a recursive solution, function A calls function B which calls function C, this is called ________ recursion. indirect three function call direct continuous what's 4 divided by 142.09 in long division maja has an important announcement to make to her team of 12 sales representatives. to ensure that each of them receives the exact same message at the same time, maja has typed up the announcement, along with all key details, and emailed it to her team. one member of the team, raj, did not receive the email because his computer crashed. which feature of the communication process is taking place between maja and raj? group of answer choices meaning transmission decoding encoding noise For what values of m does the graph of y = 3x2 + 7x + m have two x-intercepts?m greater-than StartFraction 25 Over 3 EndFractionm less-than StartFraction 25 Over 3 EndFractionm less-than StartFraction 49 Over 12 EndFractionm greater-than StartFraction 49 Over 12 EndFraction (A) Single Step Equations1) X + 7 = 9 Which tax form does an employer use to calculate an employee's taxwithholding?