WHAT IS PHOTOSYTHESIS?

Answers

Answer 1

Answer:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities

Explanation:

Answer 2

Answer:

Photosynthesis is a process by which phototrophs convert light energy into chemical energy, which is later used to fuel cellular activities. The chemical energy is stored in the form of sugars, which are created from water and carbon dioxide.

Explanation:

:)


Related Questions

Question 9 of 10
The photo shows nervous tissue.
What is the main function of nervous tissue?
A. To cover the body to protect other cells
B. To transport materials and defend the body
C. To send signals to control the body
D. To contract to cause movement in the body

Answers

Answer:

Explanation:

To send signals to control the body

Nerve cells: Transport signals around body

Tissue: Made of many cells

The main function of nervous tissue is C. To send signals to control the body. Nervous tissue is made up of specialized cells called neurons that are capable of transmitting electrical and chemical signals throughout the body. These signals allow the nervous system to control and coordinate various body functions, including movement, sensation, and thought processes. In addition to neurons, nervous tissue also contains support cells called glial cells that help to protect and nourish the neurons. Overall, nervous tissue plays a critical role in the functioning of the nervous system and the control of bodily functions.

sequence the types of cells involved in the transmission of information from sound detection to the moment when an individual turns his or her head in response to the sound

Answers

The sequence of cells involved in the transmission of information from sound detection is hair cells> spiral ganglion cells > cochlear nucleus > superior colliculus >  motor neurons.

1. Hair cells in the inner ear detect sound waves and convert them into electrical signals.
2. Transmission of these signals to the spiral ganglion cells is done, which serve as the primary auditory neurons.
3. The spiral ganglion cells send the signals to the cochlear nucleus in the brainstem.
4. From there, the signals travel to the superior colliculus, which is responsible for directing eye and head movements.
5. Finally, the superior colliculus activates motor neurons in the spinal cord, which control the muscles involved in turning the head in response to the sound.

Overall, the process of sound transmission involves a complex network of cells and neural pathways working together to interpret and respond to auditory stimuli.

To learn more about sound, visit here:

"sequence of cells involved in the transmission of sound"   https://brainly.com/question/14267918

#SPJ11

The graph below summarizes how effective the seasonal flu vaccine has been at preventing infection with the flu virus. The data were collected over a 13-year period.

Based on the data provided, a reasonable interpretation would be that​

The graph below summarizes how effective the seasonal flu vaccine has been at preventing infection with

Answers

Based on the data provided, a reasonable interpretation would be that​ meta-analysis quantifies data reporting influenza vaccine effectiveness to prevent seasonal influenza infection.

What are the effects of influenza infection?

Flu is a contagious respiratory illness caused by influenza viruses that infect the nose, throat, and sometimes the lungs. It can cause mild to severe illness, and at times can lead to death.

Influenza viruses travel through the air in droplets when someone with the infection coughs, sneezes or talks. You can inhale the droplets directly. Or you can pick up the germs from an object — such as a telephone or computer keyboard.

For most healthy people, the flu is an uncomfortable but short-term illness that resolves itself as the immune system fights it off. Symptoms usually appear from one to four days after exposure to the virus, and they last five to seven days.

Learn more about influenza infection:

https://brainly.com/question/9764375

#SPJ1

12 Which of the following best describes
the energy change that occurs when a
stretched rubber band is
suddenly released?
(1) kinetic to potential
(2) mechanical to potential
(3) potential to kinetic
(4) kinetic to mechanical

Answers

It starts as potential and becomes kinetic when released so (3)

Why are offshore wind farms becoming more common then land based wind farms

Answers

Offshore wind farms are becoming more common than land-based wind farms due to several reasons. In this answer, we will discuss why offshore wind farms are gaining more popularity.

Firstly, offshore wind farms are less obstructive and intrusive than land-based wind farms. Offshore wind farms are usually located far from residential areas, unlike land-based wind farms, which may sometimes lead to complaints from local residents regarding noise and visual impact. With offshore wind farms, this is not a problem, and there are no visual impacts on the surrounding landscapes. Additionally, the noise generated by offshore wind farms is typically quieter, as the turbines are located further away from people.

Secondly, offshore wind farms have stronger and more consistent wind speeds. The wind speed over the ocean is usually stronger and more consistent compared to land. This is due to several reasons, including less turbulence over the ocean and no natural obstacles like mountains or trees that can obstruct the wind flow.

Thirdly, the scale of offshore wind farms is much larger than land-based wind farms. With more space available, wind farms can accommodate larger and more powerful turbines, generating more electricity. Larger wind turbines installed offshore have larger rotor diameters and can access stronger and more consistent winds, enabling them to generate more electricity than land-based turbines.

Finally, offshore wind farms have less visual impact than land-based wind farms. The turbines are much further away from the shore and are not visible to many people, so there is less visual impact. Offshore wind farms can be an attractive option for countries with limited land space and high electricity demand.

In conclusion, offshore wind farms are becoming more common than land-based wind farms due to their less obstructive nature, stronger and more consistent winds, larger scale, and less visual impact. These benefits make offshore wind farms an attractive option for countries seeking to generate more renewable energy and reduce carbon emissions.

To know more about offshore visit :

https://brainly.com/question/28773484

#SPJ11

What is an Organism?

Answers

Answer: Any living thing that functions as an individual entity, by means of organs.

Hope this helps :)

Explanation:

Reacting to stimuli, reproducing, growing, and maintaining homeostasis are all characteristics of living beings. Specified groups of organisms, such as multicellular animals and plants, are classed according to taxonomy.

A living organism is what?

A living entity is therefore anything that contains life and uses cells as its fundamental form of organization. The list of living things includes people, fungus, algae, trees, animals, bacteria, protozoa, and insects.

Is a live thing an organism?

A living thing's ability to feed, breathe, expel waste, and carry out all other essential processes of life is made possible by the components that make up its cells. The parts fit and function together because they are organized, which they are. This is the basis for the term "organism" to describe living creatures.

To know more about Organsim visit:

https://brainly.com/question/10209072

#SPJ4

which scientist determined that electrons had predicted zones orbiting the nucleus?​

Answers

Answer:

John Dalton

so i hope this is useful

Answer:

Schrödinger

Explanation:

Believed electrons do not stay in a certain orbit, but can have a predicted zone around the nucleus (electron cloud)

Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase can be used only once. charged pause site lytic mismatch promoter RBS clear origin - strand tRNA phosphorylation + strand lysogenic ppGpp uncharged sigma factor Rho factor methylation pause site cloudy Before transcription can begin, RNA polymerase must find the location and direction of a gene on the chromosome based on its sequence. RNA polymerase ends transcription at a located at the end of a gene. It is common for amino acid biosynthetic genes to be transcriptionally activated in the presence of tRNAs as a result of the Stringent response, which requires to bind RNA polymerase. An sRNA can inhibit mRNA translation by the ribosome through complementary base-pairing to the sequence in its target mRNA. During DNA replication, the sequence of the daughter strand being synthesized is determined by complementary base-pairing with the parent template strand, however DNA polymerase can incorporate a base-pair that can result in a point mutation if it is not repaired. a Bacteria can repair these mistakes and distinguish the original parent strand of DNA from the new daughter strand of DNA through of certain nucleotides. In order to replicate their genomes, all SSRNA viruses must package an RNA-dependent RNA polymerase within their capsid.

Answers

The answer to the fill-in-the-blanks with words each word or phrase can be used only once. charged, pause, site, lytic mismatch, promoter RBS, clear origin - strand tRNA phosphorylation, + strand lysogenic, ppGpp uncharged, sigma factor. Rho factor, methylation, pause site, cloudy,  is:

Before transcription can begin, RNA polymerase must find the location and direction of a gene on the chromosome based on its sequence. RNA polymerase ends transcription at a clear origin located at the end of a gene. It is common for amino acid biosynthetic genes to be transcriptionally activated in the presence of tRNAs as a result of the Stringent response, which requires charged sigma factor to bind RNA polymerase. An sRNA can inhibit mRNA translation by the ribosome through complementary base-pairing to the sequence in its target mRNA. During DNA replication, the sequence of the daughter strand being synthesized is determined by complementary base-pairing with the parent template strand, however, DNA polymerase can incorporate a base-pair that can result in a point mutation if it is not repaired. A bacteria can repair these mistakes and distinguish the original parent strand of DNA from the new daughter strand of DNA through methylation of certain nucleotides. In order to replicate their genomes, all SSRNA viruses must package an RNA-dependent RNA polymerase within their capsid.

RNA (Ribonucleic acid) is a single-stranded nucleic acid consisting of nucleotide monomers that performs essential roles in coding, decoding, regulation, and expression of genes.

DNA (Deoxyribonucleic acid) is a double-stranded nucleic acid consisting of nucleotide monomers that encodes the genetic instructions used in the development and function of all known living organisms.

Bacteria are prokaryotic microorganisms that consist of a single cell without a nucleus.

To know more about tRNA, visit:

https://brainly.com/question/29775087

#SPJ11

the base of this soild crate has an area of 6 squads meters the height of the crate is 4 meters what is the volume of the crate

Answers

Answer:

As Per Provided Information

Base area of crate 6 Height of the crate h is 4 m

We have been asked to determine the volume of the crate .

Formula used to calculate the volume of crate is

\( \boxed{\bf \: Volume_{(Crate)} = Base \: Area \times Height}\)

On substituting the given value in above formula and we obtain.

\( \qquad\longrightarrow\sf \: Volume_{(Crate)} \: = 6 \times 4 \\ \\ \\ \qquad\longrightarrow\sf \: Volume_{(Crate)} \: = 24 \: {m}^{3} \)

Therefore,

Volume of the crate is 24 .

Choose the statement that is NOT true about conditions within the given biome.
Temperate grasslands are in the wetter areas of the temperate zone.
Tundras are very cold with very little rainfall.
Steppes are cold grasslands with little precipitation.
All deserts have extremely low precipitation levels.

Answers

The statement that is NOT true about conditions within the given biomes is "Temperate grasslands are in the wetter areas of the temperate zone."

Temperate grasslands are typically found in areas that experience moderate rainfall, but they are not necessarily located in the wetter areas of the temperate zone. The distribution of temperate grasslands is more influenced by factors such as temperature, soil conditions, and vegetation types. They are characterized by a semiarid climate with moderate rainfall, but not as wet as regions with forests or higher levels of precipitation.

Tundras, on the other hand, are indeed very cold with little rainfall. They are characterized by extremely cold temperatures and a short growing season. Precipitation in tundra regions is generally low, often in the form of snow, and the frozen ground limits water absorption.

Steppes are cold grasslands with little precipitation. They are similar to temperate grasslands but tend to have colder climates and receive less rainfall. Steppes are found in regions with a continental climate and are often associated with dry and arid conditions.

Deserts are known for their extremely low levels of precipitation. They have arid or semiarid climates, which result in limited rainfall. Deserts are characterized by their dry and barren landscapes, with scarce vegetation and adaptations to survive in water-scarce environments.

Learn more about biomes visit:

brainly.com/question/30256754

#SPJ11

The nervous system is a ___________________ in which your brain _____________ and ___________________ messages about things in and around your body.

Answers

Answer:

the nervous system is a system in which your brain sends and receives messages about things in and around your body.

Explanation:

Hope This Help?

Please Mark Me Brainly!!

The pedigree diagram shows how a dominant trait is inherited in a family. The red circle and squares show family members with the trait.​

The pedigree diagram shows how a dominant trait is inherited in a family. The red circle and squares

Answers

Answer:

B. if both of the parents have it then most likely they have it too, they might not show it but they can carry it

The ability of the brain to change its anatomy over time, within limits, is known as ____.

Answers

The ability of the brain to change its anatomy over time, within limits , is known as Neuroplasticity, which is also known as neural plasticity or brain plasticity. The ability of neural networks in the brain to change through growth and recognizance.

Its the ability of human brain to change its activity in response to intrinsic or extrinsic stimuli by reorganizing its function and structure. Learning, experience and memory formation or as result of damaged the brain.

According to study music , especially when combined with dance,art,gaming and exercise which helps in promote neuroplasticity and its improve movement and coordination which help in strengthen memory of the brain.

To learn more about the Neuroplasticity here

https://brainly.com/question/689119

#SPJ4

A procedure by which a juvenile is removed from the juvenile justice process and provided with treatment services is called _____.

Answers

The procedure by which a juvenile is removed from the juvenile justice process and provided with treatment services is called diversion.

In summary, diversion is a method that aims to address the underlying issues that led to the juvenile's involvement in the justice system, rather than solely focusing on punishment. This approach allows for rehabilitation and support for the juvenile to prevent future delinquency.  An individual who is under an age fixed by law (such as 18 years) at which he or she would be charged as an adult for a criminal act are juveniles. some states also have been changing their laws to give school administrators more access to the records of juveniles whose cases were processed by juvenile courts.

In conclusion, diversion offers an alternative path for juveniles, prioritizing treatment and intervention over traditional court proceedings.

To know more about  diversion, visit

https://brainly.com/question/31080631

#SPJ11

Phenotypic variation among individuals is not always visible and can include which one of the following trait characteristics?
A. physiological differences
B. developmental, physiological and behavioral differences
C. developmental and physiological differences
D. behavioral differences
E. developmental differences

Answers

Phenotypic variation among individuals is not always visible and can include physiological differences, developmental, physiological and behavioral differences, developmental and physiological differences, behavioral differences, and developmental differences.

Phenotypic variation refers to the differences in the traits or characteristics that are visible among individuals, which result from the expression of genes as well as environmental factors. These differences can be either visible or invisible, as some traits may not be physically visible. However, these traits can still have a significant effect on the individual and their interactions with the environment.Based on the given options, phenotypic variation can include physiological differences, developmental, physiological and behavioral differences, developmental and physiological differences, behavioral differences, and developmental differences. This means that it can include a range of traits or characteristics that differ from one individual to another. Some of these differences may be related to the development of the individual, such as differences in growth rates or developmental timing. Other differences may be related to the physiology of the individual, such as differences in metabolic rates or organ size. Finally, some differences may be related to the behavior of the individual, such as differences in mating strategies or social behavior.

In conclusion, phenotypic variation is a complex phenomenon that can include a range of traits or characteristics that differ from one individual to another. These differences can be visible or invisible, but they all have a significant effect on the individual and their interactions with the environment.

To learn more about Phenotypic variation :

https://brainly.com/question/16067537

#SPJ11

1. Use the list below to complete the following statements.

adapt extinct mutation adaptations fittest natural selection criticism fossil saber-tooth tiger Darwin giant sloth survival evolution glyptodont variation

a. The term describes living things that are best suited to their environment.
b. Species that survive are the ones that make or meet changes.
c. Florida has a rich record.
d. Two examples of land animal fossils found in Florida are the ________ and the ______.
e. Some animals unable to adapt to the changing environment became ___________.
f. Living things _______________ over time to meet their changing environment.
g. This biologist, __________________, studied evolution in the 1800s.
h. The ________________ was a giant, armadillo-like animal with a spiked tail that once lived in Florida.
i. The Origin of Species is a book written in 1859 about ___________________.
j. Nature selects the fittest for ______________________because they have useful traits.
k. Changes may occur in animals due to changes in the sequence of base pairs in their DNA, and this is known as a __________________.
l. Oldfield mice show ____________________ in the color of their fur.
m. The survival of the light-colored oldfield mice on Florida's Gulf Coast is an example of the process called ________________________.
n. Evolution is a controversial theory that has survived much _________________.

2. Write a micro-theme using and explaining the following terms.

a. "Survival of the fittest"

b. Adaptation

c. Evolution

3. Use the list below to write the correct term for each definition below.

adaptation

extinct

gene

Darwin

fittest

mutation

evolution

fossils

natural selection

_________________________ a. A change in genes that causes a change in a particular trait

_________________________ b. Describes a species that no longer has any living representatives

_________________________ c. A trait that a species develops over generations which helps it to survive

_________________________ d. a unit of DNA that determines a specific trait in the organism

_________________________ e. The survival of organisms best fit for the environment

_________________________ f. Changes in living things over time

_________________________ g. Remains of organisms that lived in the past

_________________________ h. Best suited to survive in its environment

_________________________ i. The biologist who developed and offered evidence of the theory of Natural selection

4. Answer the following using complete sentences.

a. How does genetic variation create new species over time?

b. How does changing the proteins produced in a cell alter what an organism does?

c. In terms of evolution, why do animals that are preyed upon (eaten) likely to have a high number of offspring?

d. Why is it vital that a scientist recognize his or her own biases and that they be open to criticism?

5. We chose to spotlight Florida animals because The Ogburn School is located in Florida. Your next assignment is to conduct an internet search to discover information related to animal diversity. You may choose to research animals in the state you live in. If you live in Florida you may choose to research a Florida endangered species, or one from another state or country. Your research must include the following:

a. species of animal

b. location of animal (state or country)

c. the animal's status (extinct, endangered, threatened, etc.)

d. reason for status (why is animal extinct, endangered, threatened, etc.)

e. type of habitat needed for survival

f. conservation efforts on the animal's behalf

g. prospects for the future of this animal

Answers

Answer:

d=alligators, deers

E=extinct

f=reproduce

g=Mr. Kinley

H=anteater

I=Eveloution

J=survival

K= ???

L or I? = bones

Explanation:

Make me brainliest no matter what

Answer:

for  k is  mutation

Explanation:

Which of the following can be used to measure absolute time? Select all that apply.
A. varves
B. tree rings
C. law of superposition
D. ratio of C-12 to C-14 in a bone sample

Answers

B. Tree rings and C. Ratio of c-12 to c-14 in a bone sample

Which of the statements are true about the eukaryotic cell cycle? Select all that apply. The M phase consists of two events: prophase and cytokinesis. Cells that have fully differentiated and no longer divide are said to be in G0 phase. There are two stages to the cell cycle: M phase and interphase. There are three phases of interphase called: G1 phase, S phase and G2 phase. Interphase is typically the shortest of the two stages of the cell cycle.

Answers

The statements that are true about the eukaryotic cell cycle are:

Cells that have fully differentiated and no longer divide are said to be in G0 phase.There are three phases of interphase called: G1 phase, S phase, and G2 phase.

The eukaryotic cell cycle consists of various stages and events. Here are the correct statements:

Cells that have fully differentiated and no longer divide are said to be in G0 phase. G0 phase represents a non-dividing state where cells have exited the cell cycle and are in a quiescent stage.

There are three phases of interphase called: G1 phase, S phase, and G2 phase. Interphase is the longest stage of the cell cycle, where the cell prepares for division. G1 phase involves cell growth and preparation for DNA replication, S phase is the synthesis phase where DNA replication occurs, and G2 phase is the preparation for cell division.

To know more about eukaryotic cell cycle

brainly.com/question/1600289

#SPJ11

the endocrine system has many functions including . multiple select question. receiving sensory information from the environment maintaining blood volume producing neurotransmitters regulating blood ion concentrations controlling movement of food through the digestive tract

Answers

The endocrine system achieves a set of tasks, like maintaining blood volume, controlling blood ion concentrations, and guiding how food gets through the digestive tract.

The body's long-term endocrine reactions to lower blood pressure and volume form more red blood cells. Erythropoietin, which is issued by the kidneys and both signals and aids in the survival of already formed red blood cells, is made in the bone marrow.

The endocrine system is a highly organized mechanism that maintains the proper level of hormones and their effects. Using "feedback loops" is one technique to accomplish this. Other hormones, proteins, or neural impulses govern the release of hormones. The impact of the hormone is then felt by other organs.

Digestion is guided by the endocrine system and the brain. The sensations of hunger and fullness are handled by the brain. The release of hormones and enzymes vital for food digestion in the digestive tract is directed by the endocrine system.

To know more about the Endocrine system visit https://brainly.com/question/3534540

#SPJ4

The endocrine system has many functions including (b) regulating blood ion concentrations controlling movement of food through the digestive tract.

The nervous system and endocrine system combine signals coming from many body systems and the environment. The endocrine system also creates effector molecules, such as hormones, that can cause the body to react appropriately in order to maintain homeostasis.

More red blood cells are formed by the body's long-term endocrine responses to lower blood pressure and volume. The bone marrow produces erythropoietin, a hormone secreted by the kidneys that both alerts and promotes the survival of already created red blood cells.

The endocrine system is a meticulously planned process that keeps hormone levels and effects in check. One method to do this is to use "feedback loops." supplementary hormones, proteins, or neural. The hormones released are controlled by impulses. Other organs then experience the effects of the hormone.

The brain and endocrine system control digestion. The brain controls the feelings of hunger and fullness. The endocrine system controls the release of hormones and enzymes necessary for food digestion in the digestive tract.

To know more about endocrine system

https://brainly.com/question/30246042

#SPJ4

When a trait is x-linked, a single recessive allele is sufficient for a male to be affected. Why?.

Answers

When a characteristic is X-linked, a man might be influenced by just one recessive gene (because the male is hemizygous – he only has one allele of an X-linked trait).

The X-linked gene allele of a father is passed on to his daughters but not to his sons.

Why is X-linked recessive a male-only condition?

Genetic disorders connected to mutations in genes on the X chromosome are referred to as having X-linked recessive inheritance.

Because he contains just one X chromosome, a guy who carries this mutation will be impacted. A girl who carries a gene mutation in one X chromosome but has a normal gene on the other X chromosome usually has no symptoms.

Male cells include one X and one Y chromosome, while female cells contain two X chromosomes.

Learn more about recessive allele refer

https://brainly.com/question/2717245

#SPJ4

PLS HELP ASAP NO LINKS PLS
Give 3 characteristics of Biogeochemical cycle and 3 characteristics of dentrification.

Answers

an natural pathway by which essential elements of living matter are circulated.

Nitrite was the preferred nitrogen for denitrification,followed by nitrate and no significant

Que significa una celula

Answers

Unidad anatómica fundamental de todos los organismos vivos, generalmente microscópica, formada por citoplasma, uno o más núcleos y una membrana que la rodea.
Unidad anatómica fundamental de todos los organismos vivos, generalmente microscópica, formada por citoplasma, uno o más núcleos y una membrana que la rodea.

Using the characteristics of life, explain why your lab stool is not alive.

Answers

Some of the important characteristics of life are:-

Metabolism: It is a major characteristic of life without exception. All living organisms are made of chemicals. These chemicals, small or big, belonging to various classes, sizes, functions, etc., are constantly being made and changed into other biomolecules. These conversions are chemical reactions or metabolic reactions.

The sum total of all the chemical reactions occurring in our body is metabolism.

No non-living object exhibits metabolism here for eg. a lab stool that does not exhibit metabolism and hence is not alive.

Reproduction, is also a characteristic of living organisms but with a few exceptions. No non-living object is capable of reproducing or replicating by itself. Hence again it shows why a lab stool is not alive as it cannot reproduce as a living organism can.

The most complicated feature of all living organisms is the ability to sense their environment and respond to these environmental stimuli which could be physical, chemical, or biological. No nonliving object possesses such qualities.

Learn more about the characteristics of life here:-

https://brainly.com/question/6997560

A stool is non-living as it does not possess any of the characteristics of a living organism.

Characteristics of life are

1.Sensitivity or Response to Stimuli- Living organisms shows response to diverse stimuli like plants shows sensitivity to light, they bend towards the source of light. A stool does not show any kind of response to different stimuli.

2.Reproduction- All the living organisms are capable of reproduction whether sexually or asexually but a stool having no living cells is not capable of reproduction.

3.Growth and Development- Organisms do show growth in their body and their structure but a stool is similar all the time it cannot grow on its own, it can only be modified with human efforts.

4.Energy Processing- All organisms use a source of energy for their metabolic activities. Some use energy from sun like plants and some use chemical energy from different substances to carry out metabolic activities. A Stool cannot perform metabolic activities in it as it has no living cells.

5.Regulatory mechanism- Even the smallest organisms are having complex structures and require multiple regulatory mechanisms to perform functions, respond to stimuli, and do other many things.

Hernce from the above points we can conclude that a stool is nonliving object as it does not show any response to stimuli, has no growth and development, is incapable of reproduction, also need no energy.

To know more about characteristics of life, follow the given link below:

https://brainly.com/question/11544643

#SPJ4

the superior esophageal sphincter is also called the ______ sphincter.

Answers

The superior esophageal sphincter is also known as the upper esophageal sphincter (UES). It is a circular muscle located at the uppermost part of the esophagus, just below the pharynx.

The UES plays an important role in regulating the flow of food and liquids into the esophagus and preventing them from entering the trachea (windpipe) and lungs. It remains closed at rest, but relaxes and opens briefly during swallowing, allowing the bolus of food or liquid to pass through into the esophagus. Once the bolus has passed, the UES contracts again, creating a tight seal to prevent any further material from entering the esophagus. Dysfunction of the UES can lead to problems with swallowing, aspiration (breathing in food or liquid), and other esophageal disorders.

To Know more about esophageal sphincter visit:

brainly.com/question/31178784

#SPJ11

Dioxin, produced as a by-product of various industrial chemical processes, is suspected of causing cancer and birth defects in animals and humans. It apparently acts by entering cells, binding to proteins, and altering the pattern of gene expression. The proteins affected by dioxin are probably __________.

Answers

The proteins affected by dioxin are probably the aryl hydrocarbon receptor (AhR).What are dioxins?Dioxins are a group of chemical compounds that are often formed as by-products of industrial processes

. Dioxins are environmental pollutants that are also formed through natural processes like forest fires, volcanoes, and wildfires. They are persistent and can travel long distances. Dioxins are highly toxic and can cause serious health problems.

Dioxins have been associated with cancer, damage to the immune system, and reproductive and developmental problems, among other things. Explanation:The main answer is the aryl hydrocarbon receptor (AhR) is probably the proteins affected by dioxin.

To know more about proteins visit:

https://brainly.com/question/27862350

#SPJ11

jean-baptiste lamarck was one of the first scientists to propose a method for evolutionary change. he suggested that an organisms body would adapt to its surrounding based upon the use or disuse of certain body parts. why was this a a mistaken idea?

Answers

Jean-Baptiste Lamarck's idea that an organism's body would adapt to its surroundings based on the use or disuse of certain body parts was a mistaken idea for several reasons.

Firstly, it ignores the fact that traits are inherited genetically, and not acquired through an individual's lifetime. Secondly, it does not account for the role of natural selection in driving evolutionary change.

For example, Lamarck's theory would suggest that if a giraffe stretched its neck over time to reach higher branches, its offspring would inherit a longer neck. However, we now know that the length of a giraffe's neck is determined by genetic factors, and the longer-necked individuals are more likely to survive and reproduce due to their ability to access food resources, resulting in the trait becoming more prevalent in the population over time.

Additionally, Lamarck's theory does not explain why some body parts have evolved to have no apparent use, such as vestigial organs like the human appendix. These structures may have been functional in ancestral species but have become unnecessary over time through changes in the environment and natural selection.

Overall, while Lamarck's ideas were important in the history of evolutionary thought, they have been superseded by more modern theories that take into account the role of genetics, natural selection, and other factors in driving evolutionary change.

Learn more about vestigial organs here:

brainly.com/question/21377023

#SPJ11

Fill in the blanks:
1. Light-touch receptor located at the epidermal-dermal border:__________.
2. Light-pressure receptor located in papillary layer of dermis: ____________.
3. Deep pressure receptors:__________.
4. Receptors that respond primarily to pain and temperature:________.
a. Merkel cells.
b. nociceptors.
c. lamellated corpuscle.
d. tactile corpuscle.

Answers

Answer:

1. merkel cells

2. tactile corpuscle

3. lamellated (lamellar) corpuscle

4. nociceptors

Explanation:

Merkel cells are epithelial cells found around hair follicles which are capable of sensing gentle touch sensations such as, for example, tactile discrimination and environmental exploration. Tactile corpuscles are a class of nerve ending required for mediating sensitivity to light touch sensations. The lamellar corpuscles are another class of nerve ending capable of sensing deep touch sensations and vibrations. Finally, nociceptors are somatic sensory receptors capable of sensing noxious (damaging) stimuli.

1. Light-touch receptor located at the epidermal-dermal border: Tactile corpuscles (D)

Light-touch sensors called tactile corpuscles, sometimes referred to as Meissner's corpuscles, are situated near the epidermal-dermal boundary. They are located in the papillary layer of the dermis's dermal papillae, which are tiny, finger-like projections.

Particularly dense populations of tactile corpuscles can be seen in skin regions like the lips, palms, and fingertips that are sensitive to gentle touch.

2. Light-pressure receptor located in the papillary layer of the dermis: Merkel cells (A)

3. Deep pressure receptors: Lamellated corpuscle (C)

4. Receptors that respond primarily to pain and temperature: Nociceptors (B)

To know more about Tactile corpuscles:

https://brainly.com/question/32370689

#SPJ6

Based on the graphs of the rate of photosynthesis, answer both parts below.

​A company in Salt Lake City is trying to build an indoor farming facility to help people in the city and surrounding areas have more access to fresh food. However, they are realizing that it takes a lot of electricity to grow plants indoors. They have heard that they can save money using LED lights with specific color wavelengths to help save money. Specific colors can help to make sure the electricity being paid for is energy that is then used by the plants being grown.

Part A
Which color light(s) are the best for plants to grow indoors?

A) white
B) red
C) yellow
D) green
E) blue
Part B
Choose the explanation(s) below that support your answer from Part A.
A) It is the same as the light plants receive outside.
B) The absorption spectrum of plants shows those colors as the most effective.
C) Green plants will reflect the green light.

Answers

The color of light(s) that are the best for plants to grow indoors are violet-blue light with a 400 – 520 nanometer range (Option E). They are best for chlorophyll absorption and photosynthesis. The option that supports the answer above is: "The absorption spectrum of plants shows those colors as the most effective" (Option B).

What is the Absorption Spectrum of light?

This spectrum is made up of light frequencies communicated with dark bands when electrons absorb energy in the ground state in order to reach higher energy levels. When atoms absorb energy, they form this sort of spectrum.

An absorption spectrum is made up of the frequencies of light transferred with dark bands when electrons in the ground state absorb energy to attain higher energy states.

The absorption spectrum of chlorophylls comprises wavelengths of blue and orange-red light, as evidenced by maxima at 450-475 nm and 650-675 nm, respectively.

Learn more about photosynthesis:
https://brainly.com/question/19160081
#SPJ1

2. Describe how body plans provide useful information yet should be interpreted cautiously as evidence of evolutionary relationships

Answers

Body plans provide useful information about evolutionary relationships, but they should be interpreted cautiously because similar body plans can evolve independently in unrelated lineages through convergent evolution.

Body plans provide useful information about the structural and functional characteristics of different groups of organisms and can be used to infer evolutionary relationships among them.

For example, similarities in body plans such as segmentation or the presence of a notochord can suggest that different groups of animals are related and share a common ancestor.

However, body plans should be interpreted cautiously as evidence of evolutionary relationships because they can be subject to convergence, where unrelated organisms evolve similar structures due to similar ecological or functional pressures.

For example, dolphins and sharks have similar streamlined body shapes, but this is not evidence of a close evolutionary relationship between them.

In addition, body plans may not reflect the true relationships among organisms because they are based on similarities in morphology and do not necessarily reflect evolutionary history.

For example, molecular data may reveal that two seemingly dissimilar groups of organisms are actually closely related, despite differences in body plans.

Therefore, while body plans provide useful information about the characteristics of different organisms, they should be used in conjunction with other lines of evidence such as molecular data to determine evolutionary relationships more accurately.

For more such answers on evolutionary relationships

https://brainly.com/question/13872333

#SPJ11

Please help!

1. RNA contains____, which replaces___ in DNA

a. Adenine, cytosine

b. uracil, thymine

c. thymine, adenine

d. guanine, cytosine


2. Which of the following are involved in protein synthesis?

a. transfer RNA only

b. messenger RNA only

c. ribosomal RNA and transfer RNA only

d. messenger RNA, ribosomal RNA, and transfer RNA


3. Which pf the following makes a copy of DNA to serve as the pattern for genetic code and protein synthesis?

a. rRNA

b. tRNA

c. mRNA

d. RNA polymerase


4. Which sugar is present in the structure of RNA?

a. ribose

b. deoxyribose

c. glucose

d. lactose


5. What is the product of transcription?

a. RNA molecules

b. DNA molecules

c. RNA polymerase

d. proteins


6. Use the codon chart above to determine the amino acid produced from the RNA Codon of UCA.

a. leucine

b. Proline

c. tyrosine

d. serine


7. What occurs during the translation process?

a. Messenger RNA is made from DNA.

b. The cell uses information from messenger RNA to produce proteins.

c. Transfer RNA is made from messenger RNA

d. Copies of DNA molecules are made.


8. Genes contain the keys for constructing

a. purines

b. nucleosomes

c. proteins

d. pyrimidines


9. Which of the following is a point mutation?

a. A mutation involving a segment of a chromosome

b. A mutation involving the addition of one or more nucleotides into a segment of DNA

c. A mutation involving a single nucleotide

d. A mutation involving one chromosome breaking off and attaching to a different chromosome


10. According to the figure above, what codon represents the amino acid Arginine?

a. AAG

b. CGC

c. UUU

d. CCC


11. Which of these is a nucleotide found in RNA?

a. ribose + phosphate group + thymine

b. ribose + phosphate group + uracil

c. deoxyribose + phosphate group + uracil

d. deoxyribose + phosphate group + cytosine


12. DNA replication results in two DNA molecules.

a. each with two new strands.

b. one with two new strands and the other with two original strands.

c. each with one new strand and one original strand.

d. each with two original strands.


13. Figure 1 below shows the structure of a (an)

a. DNA molecule.

b. amino acid.

c. RNA molecule.

d. protein.


14. DNA is copied during an action called

a. replication

b. translation

c. transcription

d. transformation


15. What is the mRNA sequence that will be formed from the DNA sequence below?

TAC CGG ATG CCA GAT CAA ATC

Answer:

Please help!1. RNA contains____, which replaces___ in DNAa. Adenine, cytosineb. uracil, thyminec. thymine,
Please help!1. RNA contains____, which replaces___ in DNAa. Adenine, cytosineb. uracil, thyminec. thymine,
Please help!1. RNA contains____, which replaces___ in DNAa. Adenine, cytosineb. uracil, thyminec. thymine,

Answers

RNA contains uracil, which replaces in thymine in DNA. mRNA (messenger RNA), rRNA (ribosomal RNA), and transfer RNA (tRNA) is involved in the process of protein synthesis. Thus, the correct options for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14 are B, D, C, A, A, D, B, C, C, B, B, C, B, and A, respectively.

What are Nucleic acids?

Nucleic acids are the biomolecules which are made up of nucleotide units and these contain genetic information of the cell in the form of long chains of DNA molecules.

In RNA, uracil is present and it is replaced with thymine in DNA.

In the process of protein synthesis, messenger RNA, ribosomal RNA, and transfer RNA are involved.

mRNA makes a copy of the DNA to serve as the pattern for genetic code and protein synthesis in the cell.

Ribose sugar is present in the RNA molecule and deoxyribose sugar is present in the DNA molecules.

RNA molecules are the product of transcription and proteins are the product of translation.

From the codon chart, the RNA codon of UCA determines the amino acid serine.

Translation is the process during which the cell uses the information from mRNA (messenger RNA) to produce proteins.

Genes contain the keys for the construction of proteins in the ribosome of the cell.

A point mutation involves the change at a single nucleotide site in the DNA molecule.

Arginine amino acid can be represented by the codon CGC as per the codon chart given in the question.

RNA (ribonucleic acid) is made up of ribose sugar, phosphate group and the uracil base.

DNA replication results in two DNA molecules with each containing one new strand and one original strand.

Figure 1 given below in the question shows the structure of amino acids.

DNA is copied during an action process called as replication.

The mRNA sequence which will be formed from the DNA sequence "TACCGGATGCCAGATCAAATC" is "AUGGCCUACGGUCUAGUUUAG".

Therefore, the correct options for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14 are B, D, C, A, A, D, B, C, C, B, B, C, B, and A, respectively.


Learn more about Nucleic acids here:

https://brainly.com/question/11309892

#SPJ1

Other Questions
What is the name of earths northernmost point How many types of political parties are there in India Class 7? Find x. (Use pic for more info) A multiple regression model Y^=?^0+?^1X1+?^2X2+?^3X3 is fit to a data set with 14 observations. If a 95% confidence interval for the mean response at X1=2,X2=?4,X3=7 is (?1,1), and a 95% prediction interval for a new observation at X1=2,X2=?4,X3=7 is (?2,2), then to three decimal places the mean square error (MSE) equals How were the New England colonies economically different from both theMiddle and Southern colonies?A. They used less slave labor than the other colonies.B. They grew more cash crops than the other colonies.C. They had more indentured servants than the other colonies.D. They built larger plantations than the other colonies. A body accelerates uniformly from rest at 2m/s^2. calculate the distance between the two points.100PTS will MARK as BRAINLIEST Schedule of cash payments for a service company Horizon Financial Inc. was organized on February 28. Projected selling and administrative expenses for each of the first three months of operations are as follows: March $160,800 April 152,800 May 139,000 Depreciation, insurance, and property taxes represent $35,000 of the estimated monthly expenses. The annual insurance premium was paid on February 28, and property taxes for the year will be paid in June. 73% of the remainder of the expenses are expected to be paid in the month in which they are incurred, with the balance to be paid in the following month. Prepare a schedule of cash payments for selling and administrative expenses for March, April, and May. Find the slope, if exists, of the line containing the pair of points. (-17.2, 17.3) and (-16.8, 6.2) A hemispherical shell with an external diameter of 500 mm and a thickness of 20 mm is going to be made by casting, located entirely in the upper part of the corresponding mold, with the maximum circle on the partition surface. If the density of the molten metal is 7.2 g / cm3 and the height of the pouring cavity above the partition surface is 300 mm, determine the metallostatic thrust that will be exerted on the upper mold at the end of casting. assuming fission-product decay power must fall to 15 mwt before refueling can begin, estimate the minimum cooling time in days for fuel irradiated to t0 water is also and nutrient required to our body. why calculate the standard cell potential at 25 c for mg(s) fe2 (aq)mg2 (aq) fe(s) express your answer to three significant figures and include the appropriate units. A project has five activities with the durations (days) listed below: Activity Precedes Expected Duration Variance. Start A, B - -A C 14 0.26 B E 11 1 C D 49 0.36 E End 32 3.38 E End 29 0 What is the probability that the project will be completed within 103 days? a. 0.82 b. 0.18 c. 1 d. 0.25 e. 0 help me here pls(solve on your own, a,b, and c)(more practice, a and b) What is appropriate to include in a teaching plan for a 9-year-old child who has had diabetes for several years A complex number of the form z = a + bi has an absolute value of 4.00. What could the values of a and b be?a = 1.6, b = 2.3a = 1.6, b = 2.5a = 1.9, b = 2.1a = 2.1, b = 3.4 Who i Charle Darwin?born in England in 1809, Darwin wa a ____________ lover who graduated from Chrit' Collage with a bachelor of art degree in 1831. Hi botany profeor recommend him for a ___________ poition on the __________ which would take him on the voyage of a lifetime. Darwin publihed ___________ which olidified him a the father of ________ biology. He died in 1882 What else would you want to know about the photograph to help you evaluate its reliability? is steel and metal are the same thing??? Le cross du college s'effectue sur le parcours schmatisci-contre en partant du point A et en suivant le sens desleonas. Les eleves de quatrieme doivent parcourir 1.5 km.On doit-on placer la ligne d'arrive sur le circuit?( measure : from A to B is 69 mfrom B to C is 72mfrom D to A is 36m )