What is the main job of the cell membrane ?

What Is The Main Job Of The Cell Membrane ?

Answers

Answer 1
I think it’s B for sure

Related Questions

suppose that the order of three genes on the same chromosome is abc. if the distance between a and b is 2.0 map units and the distance between b and c is 4.0 map units, what is the genetic distance between a and c? multiple choice question. 3.0 map units 6.0 map units 2.0 map units 8.0 map units

Answers

the order of three genes on the same chromosome is abc. if the distance between a and b is 2.0 map units and the distance between b and c is 4.0 map units, The genetic distance between a and c is 6.0 map units.

Genetic distance is a measure of genetic variability between lifeforms or between populations within a species, and it can be measured in terms of time from a common ancestor or degree of differentiation. Small genetic distances exist between populations with many roughly comparable alleles.

A genetic map displays the map distance (in cM) between any two loci as well as the place of these loci in relation to every other mapped loci. The geographical distance, which is the quantity of DNA between two loci, is approximately equivalent to the genetic map distance.

Chromosomes, which are found in the cell nucleus, contain genes. A chromosome is made up of dozens to thousands of genes. Every normal human cell has 23 pairs of chromosomes, for a sum of 46. A trait is any gene-determined distinctive feature that is frequently determined by multiple genes.

For more information on Genetic distance, visit:

https://brainly.com/question/29381763

#SPJ4

If you have a vloume of 55l and a density of 2kg/l what is the mass

Answers

Answer:

110 kg

Explanation:

Density = Mass / Volume ===> Mass = Density x Volume

Now follow the given:

- Density = 2 kg/L or 2000 g/L

- Volume = 55 L

Apply the rule:

Mass = 55 L x 2 kg/L = 110 kg or 110000 g. ( Liters is cancelled by Liters).

POSSIBLE POINIS: 5
Which of the following is the best example of a population with the terrarium ecosystem?
A
the grains of sand in the bottom of the jar
B
the air and the screen at the top of the jar
С
the paper tube and the water containers
D
the three crickets in the jar



Answers

Answer:

A

Explanation:

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

Eukaryotes can be Plant or Animal Cell, because both have _______

Answers

Answer:

A nucleus

Explanation:

Eukaryotes and Prokaryotes and the two opposites.

nucleus              no nucleus

multi-celled        single-celled

They both contain a membrane-bond organelles in

Students wonder what causes diabetes. They find that a feedback loop in the body regulates glucose level in the blood

Answers

Diabetes is a complex metabolic disorder characterized by high blood glucose levels. One of the main causes of diabetes is a dysfunction in the feedback loop that regulates glucose levels in the body.

In a healthy individual, the feedback loop involves several components. When blood glucose levels rise after a meal, the pancreas releases insulin, a hormone that signals cells to take in glucose from the bloodstream. This promotes the storage and use of glucose for energy production. Insulin helps regulate glucose levels by inhibiting the liver from producing excess glucose and promoting glucose uptake by muscle and fat cells.

In individuals with diabetes, this feedback loop is disrupted. In type 1 diabetes, the immune system attacks and destroys the insulin-producing cells in the pancreas, leading to insufficient insulin production. In type 2 diabetes, the body becomes resistant to the effects of insulin or doesn't produce enough insulin to maintain normal blood glucose levels.

The dysfunction in the feedback loop results in elevated blood glucose levels, leading to various symptoms and complications associated with diabetes.

The disruption of the feedback loop helps to shed light on the underlying mechanisms of diabetes and the importance of managing blood glucose levels through appropriate medical interventions, lifestyle modifications, and monitoring.

For more such questions on Diabetes

https://brainly.com/question/26666469

#SPJ11

are phenols and glycosides induced or pre-existing defenses mechanisms for plants immunity ?​

Answers

Phenols and glycosides are pre-existing defense mechanisms in plants' immune systems. These compounds are part of the plant's chemical defense arsenal and are present in various tissues even before any attack or infection occurs.

Phenols are secondary metabolites found in plants that have antimicrobial and antioxidant properties. They contribute to the plant's defense against pathogens by inhibiting the growth and development of microorganisms. Phenols also play a role in wound healing and lignification, which strengthen the plant's cell walls.

Glycosides are another class of secondary metabolites found in plants that have diverse functions, including defense against herbivores and pathogens. Some glycosides act as toxic compounds when ingested by herbivores, while others can inhibit the growth of microorganisms or interfere with their feeding behavior.

Both phenols and glycosides are produced by plants as part of their constitutive defenses, meaning they are present at baseline levels even in the absence of stress or attack. However, their production can be further induced or enhanced in response to specific stimuli, such as pathogen invasion or herbivore feeding.

For more such answers on phenols

https://brainly.com/question/29415279

#SPJ8

Situations where negative peer pressure is commonly felt include all of the following EXCEPT: A. drugs, alcohol, and tobacco use B. truancy and academic dishonesty C. sexual activity D. studying in a group for a test Please select the best answer from the choices provided. A B C D Mark this and return

Answers

Answer:

D.

studying in a group for a test

Explanation:

edge2020

It can lower one's self-esteem and result in subpar academic performance, estrangement from family and friends, or an escalation of depression and anxiety. Thus option D is correct.

What negative peer pressure is commonly felt to include?

This involves bribery, threats, taunting, persuasion, and other forms of coercion. While passive peer pressure does not entail manipulation or persuasion, it is comparable to active peer pressure in that it influences you to do something you do not want to do. It has a softer edge.

Negative peer pressure might include demands to behave or dress a certain way. Cheating, allowing others to copy your work, or copying someone else's work. Excluding some individuals from social events.

Therefore, studying in a group for a test.

Learn more about peer pressure here:

https://brainly.com/question/18590062

#SPJ3

help me with the one that is in blue

help me with the one that is in blue

Answers

Answer:

I think one is nitrogen. We have approximatly 78% of that in the atmosphere.

Another would be oxygen we have 21% of that.

We have argon and we have 0.93% of that.

Lastly we have carbon dioxide. And we have 0.04% of that.

Hope this helps.

I’ll mark as brainliest

Ill mark as brainliest

Answers

Answer:

Mitosis

Explanation:

Answer: b

Explanation:

Two rough black guinea pigs when bred together have two offspring. One of them is rough white and the other is smooth black. What are the genotypes of these parents?

Parent 1 __________ Parent 2 ___________

Answers

Answer:

Parent 1 = RrBb

Parent 2 = RrBb

Explanation:

This question involves two genes in guinea pigs. The allele for rough coat (R) is dominant to smooth coat (r), and the allele for black coat (B) is dominant to white coat (b).

According to this question, two rough black guinea pigs when bred together produced two offsprings. One of the offsprings is rough white (R_bb) and the other is smooth black (rrB_). This means that, to produce such offsprings, the parents must be both heterozygous for both genes (RrBb). Please find the punnet square for this cross attached

Two rough black guinea pigs when bred together have two offspring. One of them is rough white and the

Name a involuntary muscle

Answers

Involuntary muscles are the muscles that move without conscious control of the organism and are controlled by the autonomic nervous system.

Some examples of this are:

• the ,cardiac muscle, (,heart,)

,

• smooth muscles,, like the ones found in the ,stomach,, ,intestine,, and, bladder.

Lesson Question:How can the presence of
one species benefit another in the same
ecosystem?
Check all correct elements below that you
included in your question.
independent variable: presence of one
species (here, worms)
dependent variable: effect on another
species (here, lima bean plants)
relationship: benefit
DONE

Answers

Mutualism is a type of symbiotic relationship where all species involved benefit from their interactions.

How can the presence of one species in the same ecosystem assist another?

A mutualism occurs when two species have a long-term relationship that benefits both of them (+/+ interaction). Some fungi, for example, create mutualistic relationships with plant roots. The plant may photosynthesize and gives fixed carbon to the fungus in the form of sugars and other organic compounds.

The presence of several species in an ecosystem balances it. The species in an ecosystem interact with one another in some way. For example, the existence of a plant species will offer food for the numerous herbivores found in an ecosystem. A predator may consume a variety of prey. As a result, the existence of diverse prey reduces the likelihood of a species becoming extinct in the ecosystem. As a result, all creatures in an ecosystem are dependent on one another in some way.

To learn more about Mutualism to refer:

https://brainly.com/question/9557750

#SPJ1

Which are the 3 major areas of society affected by science?

Answers

Answer:

Explanation:

the three major areas of society affected by science are economic democratic and cultural

mark me brainlist if my answer is right

During which month is carrying capacity most likely to be limited by water?

O A. August
• B. November
c. September
O D. June

During which month is carrying capacity most likely to be limited by water?O A. August B. Novemberc.

Answers

The month that is carrying capacity that is most likely to be limited by water is: c. September.

What is the carrying capacity?

This is due to the graph's apparent abrupt dip in water level around September, which indicates a decrease in the amount of available water resources.

As a result, the low water supply during this month may limit the carrying capacity, which refers to the maximum number of people that an area can support sustainably.

Therefore the correct option is C.

Learn more about carrying capacity here:https://brainly.com/question/14645317

#SPJ1

Answer:

A

Explanation:

During which month is carrying capacity most likely to be limited by water?O A. August B. Novemberc.

How are the starting reactants and the products of photosynthesis and cellular
respiration related?

Answers

Answer:

photosynthesis converts carbon dioxide and water into oxygen and glucose

Explanation:

cellular respiration coverts oxygen and glucose into water and carbon dioxide


d) What happens to a microscope if place at the edge?

Answers

When the object is placed on the slide and is in focus for each objective, the space between the slide and the objective lens gets reduce, so the microscope shouldn't be set exact at the edge.

As the objective magnification increases, the working space also increases. Therefore, you need to change it to a higher power target.

Change the focus knob to increase the stage as you look at the objective lens and stage from the side. Without permitting the objective to make contact with the coverslip, increase it as high as it can go. The sample's focus or the condenser and light intensity might need to be arranged.

Thus the accurate way to focus is that adjustments need to be made effectively and smoothly

To learn about Microscope.

https://brainly.com/question/14599847

#SPJ9

Lab Report for Digestive and Excretory

Answers

The digestive and excretory system are two interconnected physiological systems responsible for breaking down food and eliminating waste products from the body.

In this lab report, we examined the process of digestion and excretion in a variety of organisms, including humans, frogs, and worms. Through a series of experiments and observations, we were able to identify the key components and processes involved in each system, such as the role of enzymes in digestion and the function of different organs in excretion.

We also investigated the effects of various factors, such as diet and hydration, on the efficiency of these systems. Overall, this lab provided valuable insight into the complex and essential processes of digestion and excretion in living organisms.

Learn more about digestion, here

https://brainly.com/question/4941072

#SPJ1

A unicellular organism reproduces asexually through binary fission. If the parent cell contains 28 chromosomes, how many chromosomes are contained within the daughter cell?

Answers

Each daughter cell will have 30 chromosomes.

Prokaryotes and a few single-celled eukaryotes frequently engage in binary fission, a kind of asexual reproduction. In this type of asexual reproduction, the parent cell divides into two brand-new daughter cells. The genetic material of the parents is split and duplicated into two pieces throughout this procedure. Here, the DNA of each daughter cell is duplicated.

When prokaryotic organisms reproduce, this is their main strategy. Without the cell forming a spindle mechanism, binary fission takes place. The one DNA molecule initiates replication in this process, attaching each duplicate to different regions of the cell membrane as it goes. The original (real) and duplicated chromosomes separate when the cell begins to be dragged apart.

To know more about chromosomes, visit:
https://brainly.com/question/1596925
#SPJ1

Which of the following choices is an example of a non-specific barrier?skinwhite blood cellslymphatic systemthe immune system

Answers

The defense system of the body

The skin is a non-specific barrier because it protects the body from non-especific pathogen agents, covering a major diversity of possible disease carriers.

Which step in photosynthesis does not need light?

Answers

Answer: Dark Reaction

Explanation: Its the second stage of photosynthesis and it does not require light.

Work is done when force is applied
a
for a long enough period of time.
b in the opposite direction that the object moves.
in the same direction that the object moves.
two of the above

Answers

Answer:

the answe will be back

Explanation:

I am sorry of it is not right

What is a trait that probably has a complex pattern of inheritance? Explain your response

Answers

Answer:

An example of a complex trait is weight.

Complex trait or quantitative trait is a trait that doesn’t behave according to simple Mendelian inheritance laws. These traits show a continuous range of variation and are influenced by both environmental and genetic factors. It is often said that complex traits are those that are influenced by more than one factor.

Explanation:

A mutation that occurs in the gametes of an organism will most likely be transferred to which of the following?

the other organisms living nearby
the other organisms living nearby

the siblings of the organism
the siblings of the organism

the mating partner of the organism
the mating partner of the organism

the offspring of the organism

Answers

Answer:

The offspring of an Organism :)

Explanation:

A mutation that occurs in the gametes of an organism will most likely be transferred to the offspring of the organism. Thus, the correct option is D.

What is Mutation?

A mutation is a change which occurs in the DNA sequence, either due to mistakes when the DNA is being copied on to the daughter cells or as the result of environmental factors such as UV light and cigarette smoke.

There are different types of Mutations which include Chromosomal aberrations, Point Mutations, and Frameshift Mutations. These can change the proteins which are synthesized from the DNA.

Therefore, the correct option is D.

Learn more about Mutation here:

https://brainly.com/question/13923224

#SPJ2

What are the importance in applying fertilizer to a tree?​

Answers

Answer:

It helps in growth of fruits or root faster .

Explanation:

If fertilizers is applied on trees , insect won't affect and soil will be fertilized for appropriate growth .

What part of the brain is the arrow pointing to in the diagram?

What part of the brain is the arrow pointing to in the diagram?

Answers

Answer:

The Occipital Lobe

Explanation:

The Brain is the part of the central nervous system enclosed in the cranium of humans other vertebrates, consisting of soft, convoluted mass of gray and white matter and serving to control and coordinate the mental and physical actions.

The Occipital Love is the most posterior love of each cerebral hemisphere, behind the parietal and temporal lobes.

The promoter is equivalent to?

a.
start codon

b.
Terminator Sequence

c.
Primer

d.
Primase

e.
3'-UTR

Answers

Answer:

D. Primer

Explanation:

I think it's primer but I'm honestly not sure

The diagram below depicts part of the DNA structure during replication. Knowing that H represents Thymine. K represents ____
A) Thymine. B) Adenine. C) Cytosine. D) Guanine.

The diagram below depicts part of the DNA structure during replication. Knowing that H represents Thymine.

Answers

Answer:

sorry need points

Explanation:

im new

uses of biotechnology in washing powder making

Answers

Answer:

Here are some uses of biotechnology in the production of washing powders:

Enzymes: Enzymes are commonly used in washing powders to enhance the cleaning efficiency and remove various types of stains.  Proteases, amylases, lipases, and cellulases are examples of enzymes used in washing powders. These enzymes break down protein-based, starch-based, lipid-based, and cellulose-based stains, respectively, into smaller fragments, making them easier to remove during the washing process.

Bio-surfactants: Surfactants are essential components of washing powders as they help to remove dirt and oil from fabrics. Biotechnology allows for the development of bio-surfactants, which are surfactants derived from biological sources, such as bacteria or yeast. These bio-surfactants are more environmentally friendly than traditional surfactants as they are biodegradable and have lower ecological impact.

Microbial Strains: Biotechnology can be used to isolate, characterize, and optimize microbial strains that produce enzymes or bio-surfactants. Microorganisms, such as bacteria and fungi, can be engineered or selected for their ability to produce specific compounds that enhance the cleaning performance of washing powders.

Genetic Modification: Genetic modification techniques can be employed to enhance the properties of microorganisms used in the production of enzymes or bio-surfactants. This allows for the creation of microorganisms with improved characteristics, such as increased enzyme activity or enhanced stability under varying conditions.

Fermentation Processes: Biotechnology facilitates the use of fermentation processes to produce enzymes and bio-surfactants at a large scale. Fermentation involves the controlled growth of microorganisms in bioreactors, where they produce enzymes or bio-surfactants through metabolic processes. This enables the efficient and cost-effective production of these ingredients for use in washing powders.

Explanation:

which sequence correctly list how chromosomes are packed smallest to largest
chromosomes, chromatic, DNA and protein
DNA and protein, chromatic, chromosomes
DNA and chromatic, protein, chromosomes ​

which sequence correctly list how chromosomes are packed smallest to largest chromosomes, chromatic,

Answers

Answer:

The answer is the second option.

Answer:

I feel like the answer is c

I'm not too sure

Other Questions
a person who steps outside first thing in the morning to smell the air, feel the breeze on their face, and see the rays of light as the sun rises would be doing which type of processing? What causes convection currents, and what do they do? the graph above represents the data collected under certain conditions for the decomposition of n2o4(g) according to the chemical equation above. based on the graph, at approximately which time is equilibrium established? While selecting a name for a partnership, if the name is other than that of the partners, the partners must give notice as to their actual identity under the state's ______.A. fictitious-name certification lawB. annexed-name statuteC. suppositious-name lawD. fictious-name ruleE. assumed-name statuteE What is the y-intercept of the line 3x 4y = 24? Situation 2A customer walks into your department and asks if anyone can help her. She complains that she'sbeen waiting for the salesperson in the shoe department for the last 10 minutes. She says, "Justwhen I think he's finally going to help me, he takes another phone call. I'm so upset. I just want totell his manager how rude he's been."Policy: Employees should try to handle all customer complaints. If the customer demands to see amanager, call the departmental manager immediately.19sty what architectural characteristics did abbot suger employ at saint-denis that became define gothic style? Tom and Jerry opened a new lawn service. They provide three types of services: mowing, fertilizing, and planting trees. The cost of mowing is $35.00 per 5,000 square yards, fertilizing is $30.00 per application, and planting a tree is $50.00. Write an algorithm that prompts the user to enter the area of the lawn, the number of fertilizing applications, and the number of trees to be planted. The algorithm then determines the billing amount. (Assume that the user orders all three services.) A sack bar weighs 53 g and 10% of the way is sultanas how many grams of sultanas are in the snack bar dendritic cells are phagocytic, but also capable of ingesting large amounts of extracellular fluid and its contents, a process known as macropinocytosis. what specialized function do dendritic cells have in immunity that might account for their need to perform macropinocytosis? For all horizontal lines the domain is A borrower purchased a car for $23,725 and made a down payment of $2,225. The borrower was approved for a five-year installment loan with an interest rate of 9.75% and monthlypayments of $454.17. What is the total cost of the car after five years?O $27,250.20O $29,475.20O $31,981.25O $34,206.25 in the "divide" stage, cells begin the [___________________] phase, when cells split in two over and over again. What is the radius of this circle? Question 3:Hank is throwing a party. The party costs $20 per person. Answer the questions below to describe the relationship between the cost of the party and the number of friends attending.The independent variable is .The dependent variable is .The equation that can be used to represent this relationship: If 50 people attended, what would be Hank's cost? (Only input numeric values, no commas, decimal points, or symbols.) Describe the formation of the state of Israel. Be sure to include the terms Zionism and the Holocaust in your response.Describe the events and aftermath of the 1948 Arab-Israeli War, and explain how nationalism played a part in the conflict. widget corp. has to choose between two mutually exclusive projects. if it chooses project a, widget corp. will have the opportunity to make a similar investment in three years. however, if it chooses project b, it will not have the opportunity to make a second investment. the following table lists the cash flows for these projects. if the firm uses the replacement chain (common life) approach, what will be the difference between the net present value (npv) of project a and project b, assuming that both projects have a weighted average cost of capital of 14%? The price of an item yesterday was 135 . Today, the price fell to 54. Find the percentage decrease. which of the following statements expresses a value claim? group of answer choices the market capitalization of wal-mart is greater than that of target. the goodness or badness of a human action is determined by its consequences. christo's project in central park cost $21 million. aldous huxley wrote brave new world. the yankees are the best team in major league baseball. Points A, B, and C, form a triangle. The distance between point A and point B is 15 yards. The distance between point B and point C is 25 yards. Pete walks directly from point A to point C, without passing through point B. What is the direct distance from A to C?How far would Pete walk if he went from A to B to C? yardsThe direct distance from A to C is more than yards.The inequality w < represents the distance, w, that Pete might save by taking the direct path.