which hypothesis is false?


Hypothesis #1 If the mass of an object increases, then its kinetic energy will increase proportionally because mass and kinetic energy have a linear relationship when graphed.


Hypothesis #2 If the speed of an object increases, then its kinetic energy will increase proportionally because speed and kinetic energy have a linear relationship when graphed

Answers

Answer 1

Answer:

#2

Explanation:

I don't really think either of them are false though. They're both technically accurate but I believe it's #2


Related Questions

following are the types of functions performed by proteins in the human body
Storage
Support
Regulation
Defence

Select the appropriate type of function of proteins for each of the given descriptions
Description Type of Function
1. Recognition of foreign molecules ????
2. Receptors of extracelluar signals ????

Answers

Answer:

1. Recognition of foreign molecules - Defense

2. Receptors of extracellular signals - Regulation

Explanation:

The feeling of being in a forest of trees that are some of the biggest and oldest creatures ever to live on the planet is known as a(n) __________ ecosystem service.

Answers

A biophilia ecosystem service is the sensation of being among a forest of trees, some of the largest and oldest organisms to have ever existed on Earth. Edward O. Wilson, a biologist and naturalist, invented the word "biophilia" to explain how people are inherently drawn to the natural world.

The advantages individuals experience from being in a natural setting include bettering their physical and mental health, increasing their creativity and productivity, and feeling more content.

These advantages are referred to as "biophilia ecosystem services." In this aspect, trees are especially crucial since they offer a range of ecosystem services including clean air, water filtration, and wildlife habitat.

Learn more about ecosystem  at:

https://brainly.com/question/1673533

#SPJ1

what geological process returns carbon in the atmosphere form of carbon dioxide

Answers

I’m pretty sure the answer is “ subduction “

how is the information between our dna structured

Answers

The similarly alongside the cladogram you move,the greater variations in DNA the organisms have compared to the common ancestor.

What is cladogram?

A cladogram has been an evolutionary tree that diagrams the ancestral relationships amongst organisms. DNA sequence analysis of the hemoglobin alpha gene shows that humans and chimpanzees have a more similar sequence to each other than they do to the gorilla’s DNA sequence.

Analogies structure has been body parts that have a similar function but differ in structure. All vertebrate embryos have a tail and gill slits at some point during embryonic development.

Therefore, The similarly alongside the cladogram you move,the greater variations in DNA the organisms have compared to the common ancestor.

Learn more about DNA on:

https://brainly.com/question/264225

#SPJ1

PLS help!! Thank you.

Assume that two strands of DNA have been separated and that the base sequence on one strand is AGCC. What is the sequence of bases on the complimentary strand of DNA?

A. GCTT
B. TCGG
C. AGCC
D. TACA

Answers

The DNA Base complement is
adenine(A) base with thymine(T) and guanine(G) base with cytosine(C) A = T, G ≡ C. The correct answer is B) TCGG

Summarize your results from your data tables. Compare the results from the respirometers containing germinating and dormant peas. Speculate about the cause(s) of any difference between the two pea samples, and explain your reasoning.

Answers

The data tables show that the respirometers containing germinating peas consumed more oxygen than the respirometers containing dormant peas. The difference between the two samples was most evident during the first 10-minute interval. After this time, the oxygen consumption of the two groups became more similar.

This difference can be explained by the fact that germinating peas are actively growing and require more energy than dormant peas. As a result, they consume more oxygen through cellular respiration. Dormant peas, on the other hand, are not actively growing and require less energy, so they consume less oxygen.

The difference in oxygen consumption between the two groups decreased over time because the germinating peas eventually used up their stored energy and slowed down their metabolic rate. The dormant peas, however, continued to consume oxygen at a relatively constant rate because they had less stored energy to begin with.

Overall, the data suggest that the metabolic rate of peas is influenced by their growth stage and energy needs. Germinating peas require more energy and therefore consume more oxygen than dormant peas.

Draw the noncyclic amp molecule after it has dissolved in water

Answers

Answer:

When a cyclic AMP is dissolved in water it loses its bond between its P atom and its main aromatic ring. In the pictures attached, is shown in red the bond that's lost. The cyclic AMP is a messenger involved in many biological processes.

Draw the noncyclic amp molecule after it has dissolved in water
Draw the noncyclic amp molecule after it has dissolved in water

PLEASE HELP TIME RUNNING OUT THANK YOU

In the early 1900s, fire ants came to the mainland United States aboard ships that had docked in their native South America Within several years, fire ants had spread across the southern United StatesToday, many products are available to control fire ants. However, when all fire ants are eradicated from an area, many different species of ants begin to cause disturbances When one fire ant mound is reintroduced, no other ants cause problems. What could explain this behavior?

A. All the species of ants are dying out because of the warmer weather
B. Because fire ants are an introduced species, they do not socialize with other ants. Why they are removed, the other ant species become more active.
C. Fire ants do not allow any other ants in their territory, but when they are eradicated, the other ants resurface.
D. Only the fire ants are becoming resistant to the chemical pesticides

Answers

This could explain as fire ants do not allow any other ants in their territory, but when they are eradicated, the other ants resurface. The correct option is c.

What are fire ants?

Over a century ago, two kinds of imported fire ants were mistakenly introduced into the port of Mobile, Alabama, from South America. Around 1918, the imported black fire ant arrived, followed by the red fire ant in the late 1930s. Both species most likely arrived in soil used in cargo ships as ballast.

Therefore, the correct option is C. Fire ants do not allow any other ants in their territory, but when they are eradicated, the other ants resurface.

To learn more about fire ants, visit here:

https://brainly.com/question/29074600

#SPJ1

Define population and community.

Answers

Answer:

A population is a group of organisms belonging to the same species that live in the same area and interact with one another. A community is all of the populations of different species that live in the same area and interact with one another. A community is composed of all of the biotic factors of an area.

Explanation:

Answer:

population all the inhabitants of a particular town, area, or country.

Explanation:

community is a group of people living in the same place or having a particular characteristic in common.

Identify the functions performed by all living cells/orgamisms

Answers

All living organisms share key functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing.

Answer:

Whether in plants, humans, or animals, they connect to create a solid, well formed organism. In humans, cells build tissues, tissues form organs, and organs work together to keep the body alive.

Explanation:

if correct mark me brainliest

Look at this definition of species: "A species is a lineage of . . . populations which maintains its identity from other such lineages and which has its own evolutionary tendencies and historical fate." This definition best represents the:

Answers

Answer:

The correct answer is - Evolutionary species concept

Explanation:

The given definition is the definition of the evolutionary species concept or the lineage species concept that can be understood by the following -

Evolutionary species concept depicts that "a species is a single lineage of ancestor-descendant populations which keeps up its character from other such lineages and which has its own evolutionary inclinations and historical fate.”

Thus, the correct answer is - Evolutionary species concept

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

Now you will focus on second hypothesis this process can be very similar to the first but this Time do you want to focus only on the second variable in the question speed what could be a hypothesis would illustrate the relationship between speed and kinetic energy is the format of if then because when writing your hypothesis

Answers

Answer:

If the speed of an object increases, then its kinetic energy will increase proportionally because speed and kinetic energy have a linear relationship when graphed.

Explanation:

sample response, hope this helps

What sphere refers to water and ice?
a. atmosphere
b. hydrosphere
c. lithosphere
d. biosphere

Earth's outermost sphere is called the
a. biosphere.
b. atmosphere.
c. lithosphere.
d. hydrosphere.

What part of Earth contains rocks?
a. Biosphere
b. Hydrosphere
c. Atmosphere
d. Lithosphere

What of Earth's spheres is composed of a mixture of gases?
a. mesosphere
b. hydrosphere
c. atmosphere
d. biosphere

What is Earth's hydrosphere?
a. the gases in the air
b. the solid, rocky part of Earth
c. all of the water on the planet
d. the study of Earth's atmosphere​

Answers

1) It should be the crysophere but since it is not I am not sure I am going to with hydrosphere
2)B
3)D
4)C
5)C

the effects of toxic chemicals are minimized by which following three mechanisms

Answers

Answer:

Metabolic degradation, excretion, and repair.

Explanation:

PLS HELP i will make you the brainliest!

1) In order to see the sides of underwater hills, scientists use _____ to get an angle view of the ocean floor.

2)You would expect to find beaches along the continental ______.

3)Caverns, lakes, sinkholes and springs are types of _____ formation.

4)A ____ is found on the sea floor of the continental slope.

Answers

1. Echosounders
2. Margin
3. Karst
4. large block of sediment

Ty
N
Тір
- According to Figure 13-3, which code specifies the same amino acid as UAU?
Codons Found in Messenger RNA
Second Base
U с A
Phe Sor Тут Cysu
Phe Ser
Cyc
U
Lou Ser Stop
Stop A
Lou Sor Stop
G
Lou Pro His Arg U
Lou Pro His Arg
С
Lou Pro Gin
Arg
Lou
Pro Gin Ang
Thi Asn so U
А
The
Asn Bor
Bo Thr Lyo Arg A
Met Thr
Lyo
Arg
Val Ala Asp GyU
Ve Ala Aap GM С
G
Vol Als Glu ау A
Als
G
First Base
Third Base
le
Val
GY
Figure 13-3
OUAC
UAA
OUGC
UGU

TyN- According to Figure 13-3, which code specifies the same amino acid as UAU?Codons Found in Messenger

Answers

Answer:

what do you need help on what you need help

What is the utilized equipment for studying fluorescence-labelled cells? What are the advantages of labelling the cells?

Answers

Answer:

Fluorescent labeling of cells helps in ensuring more visibility of the properties of the cell.

The equipment used in studying fluorescence-labelled cells include epi-fluorescence microscope which helps in providing a more dimensional view of the cells. The spectrophotometers is also used to determine the chemical properties of the cells through the intensity of light measured with this equipment. The flow cytometer is also used in this process of study of fluorescent labeled cells.

Which two animals use echolocation?
O bats and humans
Obats and dolphins
o dolphins and humans
dolphins and butterflies
PLZ help !!!!!!!!!!

Answers

I’m pretty sure it’s Bats and Dolphins.

The correct option is B i.e. bats and dolphins use echolocation.

what is echolocation?

Echolocation is a technique used by bats, dolphins and other animals to determine the location of objects using reflected sound.

This allows the animals to move around in pitch darkness, so they can navigate, hunt, identify friends and enemies, and avoid obstacles.

Bats, whales, dolphins, a few birds like the nocturnal oilbird and some swiftlets, some shrews and the similar tenrec from Madagascar are all known to echolocate.

Another possible candidate is the hedgehog, and incredibly some blind people have also developed the ability to echolocate.

hence, the correct answer is option B.

To know more about echolocation here

https://brainly.com/question/7828418

#SPJ2

In many popular fictional movies and books, future projections of the earth (and other fictional planets) show a world devoid of plants, with civilization bustling with activity throughout a worldwide city of skyscrapers hundreds of stories high.
Based on your reading about photosynthesis and cellular (aerobic) respiration, is this future world possible? Explain why it is or is not possible in terms of energy flow in the biosphere.

Answers

In order for the scenario of a world devoid of plants and filled with towering skyscrapers to be possible, a new and sustainable source of energy for all life forms would need to be discovered. Photosynthesis and cellular respiration are the primary processes that power all life on Earth, including plants and humans alike.

Photosynthesis converts sunlight into organic compounds necessary for plant growth and cellular respiration releases energy from organic compounds to power biological processes. Without plants, there would be no source of organic compounds, and without cellular respiration, there would be no energy available for biological processes.

Therefore, a world without plants would require a completely different source of energy, such as synthetic materials or renewable energy sources such as wind or solar power, to power the skyscrapers and other technological advancements seen in these fictional depictions. However, these alternative energy sources would not be able to provide the organic compounds necessary for biological life and would have to be supplemented with other sources of nutrition and energy.

In conclusion, a world devoid of plants as depicted in many works of fiction is not possible based on our current understanding of the biosphere and energy flow in the ecosystem.

Plane is traveling south at 500 m/hr. Wind is blowing 80 m/hr north. What is the effect on the plane?

Answers

Answer:

The plane will be moving forward at 420 m/hr

Explanation:

The plane is traveling at 500 m/hr but there is 80 m/hr acting against it so you take away 80 from 500 which is 420.

TTT 18. All of the following are chemical approaches to control micro-organism excepts: A. Antibiotics B. Disinfectants 19. The scientific name for modern man is C. Antiseptics D. Autoclaving A. Homo erectus B. Homo sapiens 20. In which of the following kingdoms are prokaryotic organisms placed? A. Fungi B. Protest C. Australopithecus D. None C. Planate D. Monera 21. Plants which have true roots, leaves, stem & seeds inside the fruit are A. Gymnosperm C. Mosses D. Ferns B. Angiosperm 22. Which of the following taxonomic groups contains closely related organisms? A. Genus C. Phylum B. Order D. Class 23. Malaria causing single celled parasitic protozoan is called A. Paramecium B. Salmonella C. Mosquito D. Plasmodium 24. Which one of the following kingdoms is consists of eukaryotic organisms such as yeast moulds and mushrooms? A. Ecosystem B. Population 26. Which of the following organism are consumers? A. Photosynthetic B. Chemosynthetic bacteria C. Green plant D. Scavengers Answer the following questions. C. Kingdom monera D. Kingdom plantae A. Kingdom fungi B. Kingdom protista 25. Ecology is a biological science that deals with all of the following except C. organism D. none​

Answers

All of the options are chemical approaches to control micro-organism excepts: B Disinfectants

19. The scientific name for modern man is: B. Homo sapiens

20. kingdoms are prokaryotic organisms placed D. Monera

21. Plants which have true roots, leaves, stem & seeds inside the fruit are: B. Angiosperm

22.  taxonomic groups contains closely related organisms A. Genus

23. Malaria causing single-celled parasitic protozoan is called: D. Plasmodium

24. kingdoms consists of eukaryotic organisms such as yeast, molds, and mushrooms A. Kingdom fungi

25. Ecology is a biological science that deals with except: D. none

26. The organism that are consumer is D. Scavengers

What is the chemical approaches to control micro-organism

Disinfectants are special chemicals that are used to kill germs or prevent them from growing on surfaces or objects. They are not usually used to control microorganisms within living things, unlike antibiotics, antiseptics, and autoclaving, which are all chemicals used to control microorganisms.

Homo sapiens is the fancy name used by scientists to refer to regular, everyday humans This is the species that humans are a part of.

Read more about micro-organism here:

https://brainly.com/question/8695285

#SPJ1

18. All of the following are chemical approaches to control micro-organism excepts: A. Antibiotics B. Disinfectants

19. The scientific name for modern man is C. Antiseptics D. Autoclaving A. Homo erectus B. Homo sapiens

20. In which of the following kingdoms are prokaryotic organisms placed? A. Fungi B. Protest C. Australopithecus D. None C. Planate D. Monera

21. Plants which have true roots, leaves, stem & seeds inside the fruit are A. Gymnosperm C. Mosses D. Ferns B. Angiosperm

22. Which of the following taxonomic groups contains closely related organisms? A. Genus C. Phylum B. Order D. Class

23. Malaria causing single celled parasitic protozoan is called A. Paramecium B. Salmonella C. Mosquito D. Plasmodium

24. Which one of the following kingdoms is consists of eukaryotic organisms such as yeast moulds and mushrooms? A. Ecosystem B. Population

25. Ecology is a biological science that deals with all of the following except Answer the following questions. C. Kingdom monera D. Kingdom plantae A. Kingdom fungi B. Kingdom protista C. organism D. none​

26. Which of the following organism are consumers? A. Photosynthetic B. Chemosynthetic bacteria C. Green plant D. Scavengers

Wings of birds,wings of insects and patagia of bats are analogous organ​? why

Answers

For example, insects use wings to fly like bats and birds, but the wing structure and embryonic origin is completely different. These are called analogous structures. ... Homologous structures share a similar embryonic origin; analogous organs have a similar function.

Explain if you agree or disagree to this statement: THE ONLY SOLUTION TO NATURAL RESOURCE CONSERVATION IS RECYLING.
(Defend your stand by describing examples and including personal experience. This should be at least 3 sentences.

Answers

The given statement that the only solution to natural resource conservation is recycling is incorrect. Thus is because reducing consumption and reusing products are also other alternatives.

Natural resources are the substances that are obtained from the nature. The examples of natural resources are coal, petroleum, wind, air, water, etc.  Natural resources have the utmost important because these are the sources for producing any other material for the use.

Recycling is the phenomenon of processing waste material so that it can be used again a aa new material. Recycling is not the only resort for conservation of nature. If a person reduces his natural resources consumption, or reuses the objects that are not easily degradable, that will also conserve the nature to a great extent.

To know more about recycling, here

brainly.com/question/23371977

#SPJ1

Physically, how did our body's change as we developed language?

Answers

The gestural theory states that human language developed from gestures that were used for simple communication. ... Gestural language and vocal language depend on similar neural systems. The regions on the cortex that are responsible for mouth and hand movements border each other.

explain the importance of all 3 biomolecules in general and for making ATP.

Answers

The three biomolecules that are used for making ATP are Lipids (fats) , Carbohydrates and Proteins

The biomolecules also known as biological molecules serve a wide range of activities and they vary in shape and their size . It is also considered  essential to life because they help organisms develop, survive, and propagate. The biomolecules interact with one another  which play a role in the development of organisms .

There are four types of biological molecules which are carbohydrates which is used as an energy source , lipids which is used for storage and support , proteins is used for supporting essential vital functions and amino acids are the developing elements that make up proteins and nucleic acids for storing genetic information .

To learn more about biomolecules

https://brainly.com/question/12299485

Which of these is an example of variation?

Identical twins having identical DNA.

Two potato plants that are clones of each other.
Two Guinea pigs having different coloured fur.
Two human beings having similar body parts.​

Answers

Answer:

Two Guinea pigs having different coloured fur

Explanation:

the variation is that there are differences between the colours, so that is the variation

Answer:

Two Guinea pigs having different coloured fur is an example of variation.

Variation refers to differences or diversity within a population. Identical twins having identical DNA and two potato plants that are clones of each other have no variation because they are genetically identical. Two human beings having similar body parts is too vague to be considered an example of variation.

Show how you would prepare 50ml of a 1.5% (wt./vol.) agarose gel given 500ml buffer and 1,000g agarose powder. You boil the resultant mix to make your gel. (Note that Volume and weight are not addable.)

Answers

To prepare 50ml of a 1.5% agarose gel, you would need to mix 7.5g of agarose powder with 500ml of buffer and then boil the mixture until it forms a gel.

What is agarose gel?

Agarose gel is a type of gel made from a polysaccharide called agarose. Agarose is a linear polymer derived from seaweed and is a natural product. It is used in many applications in the laboratory, such as electrophoresis, chromatography, and blotting.

1. Calculate the amount of agarose needed to make a 1.5% (wt./vol.) gel:

Agarose needed = (1.5% * 50ml) / (1000g/1000ml) = 0.075g

2. Calculate the amount of buffer needed to make 50ml of a 1.5% (wt./vol.) gel:

Buffer needed = 50ml - 0.075g = 49.925ml

3. Combine the agarose and buffer to make the gel:

Combine 0.075g of agarose powder and 49.925ml of buffer in a container and mix thoroughly.

4. Boil the mixture to make the gel:

Heat the mixture until it starts boiling. Boil for about 10 minutes, stirring occasionally.

5. Pour the gel into a mold and allow it to cool:

Pour the hot gel into a gel mold and allow it to cool until it sets.

To learn more about agarose gel

https://brainly.com/question/30711977

#SPJ4

A hetero gous ail yellow plant is crossed with a homorygous short green. Show the genoype od phenotypes of the Fi offspring and the probability of each.

A hetero gous ail yellow plant is crossed with a homorygous short green. Show the genoype od phenotypes

Answers

The genotype of the F1 offspring is YyTt, and the phenotype is yellow and tall. The probability of each phenotype in the F1 offspring is as follows yellow and tall is 1/2 or 50%, green and short is 1/2 or 50%.

The  genotype and phenotype of the F1 offspring

Genotype refers to the genetic makeup or combination of alleles present in an organism, while phenotype refers to the observable traits or characteristics expressed by an organism. Genotype represents the genes an organism carries, while phenotype represents the physical or observable features resulting from the interaction between genotype and the environment.

When a heterozygous ail yellow plant (genotype Yy) is crossed with a homozygous short green plant (genotype tt), the F1 offspring will have the genotype YyTt and the phenotype of yellow and tall. The probability of this phenotype occurring in the F1 generation is 50%. Additionally, there is a 50% probability of the F1 offspring having the phenotype of green and short.

Learn more on genotype here https://brainly.com/question/22117

#SPJ1

How would you count the population of something without counting individually

Answers

Answer:

You wouldn't.

Explanation:

If you didn't count individually then you would not have the accurate population of a location.

Other Questions
The imagery used in the lines allows the reader toRead the lines from "84" by Rabindranath Tagore.The bees forget to sip their honey; drunken with lightthey foolishly hover and hum....Laughter floats in the air like foam on the flood.O visualize the color of the honeycombs.o imagine the sounds of the bees and laughter.O visualize the people who are laughing.imagine what the river looks like when it floods. the body of law that creates and governs government (administrative) agencies is known as 17. Which of the following collecting duct transporters is required to concentrate urine? A) Aquaponin channels B) HATPase C) K channels D) Na channels E) Na- KCl-symporter How do you solve a^4-1=0? The Pit and the PendulumBy Edgar Allan Poe1850 commonlit asA. Completa.Abuelito est un poco nervioso. Es posible que sus nietos 1 (llegar) maana por la maana. Es importante que abuelito2 (saber) cuando van a llegar. Pero es difcil que abuelita le 3 (decir) la hora precisa de la llegada de los nietos. Esposible que maana 4 (hacer) mal tiempo. Como los nietos vienen en carro ser necesario que 5 (conducir) despacioy con mucho cuidado si hay nieve. Es mejor que ellos 6 (llegar) un poco tarde. Abuelito no quiere que ellos 7 (tener)un accidente. Es mejor que 8 (llegar) tarde pero sanos y salvos. the measure of one interior angle of a triangle is 45. What can you conclude about the other two interior angles of the triangle?One of the other angles must be a right angle.The sum of the measures of the other two angles is 135.The other two angles must be acute angles.One of the other angles must have a measure greater than 90. In the present who is the president of bangladesh? express 0.2631 correct to three decimal places Which expressions are equivalent. Picture Provided. NO LINKS! NEED ANSWER ASAP you know the number of coulombs passed and the number of moles of h2 collected. how many electrons per h2 molecule? How does the family react when the boys reveal that doodle can walk If whole tomatoes were money, which of the following functions of money would be the hardest for tomatoes to satisfy? A) unit of account B) store of value C) certificate of gold D) medium of exchange ai lm dc bi tp mn c hc vt liu ko How many molecules are in this chemical formula? 12H2SO4? PLS HELP I WILL MARK BRAINLIST!!!!!! An associates degree earns a yearly median salary ofA.$39,052B. $44,096C. $64,272D. $81,172Help me!! Please help if you can, i don't understand why some asian feel embarassed about them being asian? im just not happy about it cuz im asian too. . An aquarium contains 50 gallons of water. When the plug is pulled, water drains from the aquarium at a rate of 2 gallons per minute. How many gallons of water still remain in the aquarium after 8 minutes? Cells that are diploid (2N) have a full set of genetic information. True False