Which of the following criteria have to be met for a species to qualify as invasive? Endemic to the area, spreads rapidly, and displaces foreign species Introduced to a new area, spreads rapidly, and displaces other invasive species Introduced to a new area, spreads rapidly, and displaces native species Endemic to the area, spreads slowly, and displaces native species

Answers

Answer 1

Answer:

Introduced to a new area, spreads rapidly, and displaces native species.

Explanation:

A species is invasive when they were not present in the area before, and once that they are there, they reproduce at a high peace. The fast reproduction rate, which leads to the spread of the species in the area, causes a disbalance in the ecosystem since it eats other species, which are native because they are from that area or other species' food. As a consequence, native species die or are reduced in number because the new species invaded their habitat.

An invasive species is not endemic because they are not native to that particular area. They are always external to this one.


Related Questions

Which outcome is the main function of the light-independent reactions of photosynthesis?
Oto produce oxygen
Oto use up water
Oto use up excess carbon dioxide
Oto produce glucose

Answers

Photosynthesis occurs in two stages, light-dependent and light-independent reactions. This last one is the Calvin cycle, and its main function is to produce sugars. D. to produce glucose.

What are the light-independent reactions of photosynthesis?

Photosynthesis involves two stages: light-dependent and light-independent reactions.

Light-independent reaction is known as the Calvin cycle, and it takes place in the stroma.

During the Calvin cycle, sugars or carbohydrates are synthesized.

When carbón dioxide, CO₂, enters the leaves through stomas, it diffuses to the chloroplast stroma. Carbon atoms fixate, meaning that they incorporate into organic molecules. These molecules are used to produce 3-C sugars.

The whole process is impulsed by ATP and NADPH coming from light-dependent reactions.

The alternation of the processes of light-dependent and light-independent reactions help the cell conserve energy and matter.

Plants takes solar energy and produce ATP and NADPH. When there is no available solar energy, the plant uses these molecules to produce carbohydrates.

The correct option is D. to produce glucose

You can learn more about light-independent reactions at

https://brainly.com/question/11240542

#SPJ1

The largest diversity of plants and animals on the planet is found in one terrestrial biome.

Answers

Answer:

There are diversity of plants and animals species found on the terrestrial biome. The biome such as forest, desert are rich in variety of plants and animals. This states that largest diversity is found in almost all the types of terrestrial biome.

Explanation:

B. Liverworts (Hepatophyta)
1. Observe the living green "leafy" gametophyte stage at Station A. These organisms have leaf-
like, stem-like, and root-like structures. Draw and label structures of the liverworts. Be sure
to include labels of the following items: gametophyte, n, sporophyte, 2n, rhizoides, leaf-like
structures, and thallus.
2. Use the dissecting scope and look at the sporophyte, gametophore, rhizoides, and thallus.
What do you notice? Write down some observations of each.
3. Compare the moss to the liverworts. How are they similar and how are they different?

Answers

Answer:

Explanation:

Title: Observation of Liverworts (Hepatophyta)

Objective: To observe the living green "leafy" gametophyte stage of liverworts and compare them with moss.

Hypothesis: Liverworts and moss may share some similarities in structure, but there may be significant differences between them.

Observations:

Liverworts Structures:

Gametophyte: The main plant body of the liverwort, which is haploid (n) and produces gametes.

Sporophyte: A structure that grows from the gametophyte and produces spores. It is diploid (2n).

Rhizoides: Root-like structures that anchor the gametophyte to the substrate and absorb water and nutrients.

Leaf-like structures: Flattened structures that resemble leaves but do not have true veins or stomata.

Thallus: The entire plant body of the gametophyte, which lacks true stems or roots.

Observations of different structures in liverworts:

Sporophyte: Small and inconspicuous, growing from the gametophyte.

Gametophore: The stem-like structure that supports the gametophyte and sporophyte.

Rhizoides: Thread-like structures that attach the gametophyte to the substrate and absorb water and nutrients.

Thallus: The plant body of the gametophyte that lacks true stems or roots.

Comparison between liverworts and moss:

Similarities:

Both are non-vascular plants.

Both have a haploid (n) gametophyte and a diploid (2n) sporophyte stage.

Both reproduce by spores and require water for fertilization.

Differences:

Liverworts have leaf-like structures and a thallus, while mosses have true leaves and stems.

Liverwort sporophytes are small and inconspicuous, while moss sporophytes are tall and conspicuous.

Liverworts have rhizoides, while mosses have true roots.

Which of the following helps protect biofilms from issues such as drying out and predators

a.) Extracellular polymeric substances



b.) Quorum sensing



c.) Becoming sessile



d.) Autoinducers

Answers

Extracellular polymeric substances help protect biofilms from issues such as drying out and predators. Option A

Biofilms are complex communities of microorganisms that adhere to surfaces and form a protective matrix. They can be found in various natural and artificial environments, such as riverbeds, medical devices, and plumbing systems. Biofilms provide advantages to the microorganisms within them, including protection from environmental stresses and predators.

One of the key components that helps protect biofilms is extracellular polymeric substances (EPS). EPS are complex mixtures of polysaccharides, proteins, and DNA that are secreted by microorganisms within the biofilm. These substances form a matrix that encases the cells, providing structural support and protecting the community.

EPS help biofilms resist drying out by retaining water and preventing desiccation. The polysaccharides in EPS can absorb and retain moisture, creating a hydrated environment within the biofilm even in dry conditions. This is crucial for the survival of the microorganisms within the biofilm.

Additionally, EPS serve as a barrier against predators. The matrix formed by EPS can make it difficult for predators, such as protozoa or grazing organisms, to access and consume the microorganisms within the biofilm. It acts as a physical defense mechanism, limiting the exposure of the microorganisms to predation.

While quorum sensing, becoming sessile (immobile), and autoinducers are all important mechanisms and processes associated with biofilms, they do not directly address the protection of biofilms from drying out and predators. So Option A is correct.

For more question on biofilms visit:

https://brainly.com/question/13232627

#SPJ8

WILL GIVE BRAINLIEST IF RIGHT!!! PLS HELP

The table below provides the number of chromosomes found in the body cells of various types of organisms.


Diploid Chromosome Number
Fruit Fly 8
Human 46
Goldfish 94


Which of the following is the best explanation for why the chromosome numbers above are all even?
The diploid chromosome number represents two sets of chromosomes, one from each parent, so it is always an even number.
Animal cells always have an even number of chromosomes, and plant cells always have an odd number of chromosomes.
The diploid chromosome number is always even to ensure that equal numbers of chromosomes end up in each daughter cell during meiosis.
The number of chromosomes present in a diploid cell doubles for each generation because there are two parents.

Answers

Answer:

"The number of chromosomes present in a diploid cell doubles for each generation because there are two parent" is the one among the two statements that is the best explanation for why the chromosome numbers above are all even. The correct option among the two options that are given in the question is the second option or option "B".

Explanation:

Thankies pa brainliest poooo.

Answer:

"The diploid chromosome number represents two sets of chromosomes, one from each parent, so it is always an even number."

Explanation:

I took the test + it makes sense + I'm sorry too tired to explain, if u still have doubt just search it up, "why are chromosome numbers always equal?"

I have to match these can someone help me ASAP thank you

38. Traits that increase fitness become
more prevalent over time: _____
39. Why males of a species may have traits that
seem to decrease their chances of survival: _____
40. The effect of random events,
especially in population of small size: _____
41. When one allele changes
into a different allele: _____
42. The movement of individuals
into or out of a population: _____

A. natural selection
B. sexual selection
C. genetic drift
D. gene flow
E. mutation

Answers

Answer:

38 A

39 B

40 C

41 E

42 D

Explanation:

Ngl the first few answers seem sus but I know these are correct

Summarize the changes that might occur in a population of squirrels if acorn shells became harder

Answers

If acorn shells become harder first changes that might occur is abrasion of teeth of squirrels. In many generations they might develop different shape of teeth that would make easier for them to eat the acorn.

(p.s. could you please mark me brainliest, it would help a lot)

Darwin was influenced to propose evolution by natural selection based on changes that farmers are able to obtain by means of __________ selection.

Answers

By means of natural selection.

I think natural could be the word

which of the following elements is most likely to be the least reactive?
A. a group of 2 element
B. a group of 17 element
C an element with 1 valence electron
D an element with 8 valence electrons

Please help1!1

Answers

Answer:

D

Explanation:

8 valence electrons means it is stable, so it will not need to lose or gain electrons

Give a brief explanation of why we might want to create a butterfly garden. In your explanation include:
- what has happened to reduce butterfly numbers
- what impact has this had on biodiversity
- what is biodiversity
- why is this biodiversity loss significant

Answers

Answer:

Creating a butterfly garden can have several important benefits, particularly in the context of declining butterfly populations and the impact on biodiversity.

1. Declining Butterfly Numbers: Over the years, butterfly populations have been declining due to various factors. Habitat loss and fragmentation, pesticide use, climate change, and pollution are some of the significant contributors to this decline. These factors have resulted in the loss of host plants for butterflies and a reduction in suitable habitats for their survival and reproduction.

2. Impact on Biodiversity: Butterflies play a crucial role in ecosystems as pollinators. They visit flowers for nectar, thereby facilitating the transfer of pollen and contributing to plant reproduction. Many plant species rely on butterflies and other pollinators for their pollination, which is essential for the production of fruits, seeds, and overall plant diversity. Declining butterfly populations can disrupt this pollination process and have cascading effects on other organisms that depend on these plants.

3. Biodiversity: Biodiversity refers to the variety of life forms, including plants, animals, microorganisms, and their interactions within an ecosystem. It encompasses the genetic, species, and ecosystem diversity present in a particular area. Biodiversity is crucial for the stability, resilience, and functioning of ecosystems, providing essential ecosystem services such as pollination, nutrient cycling, and pest control.

4. Significance of Biodiversity Loss: The loss of biodiversity, including declining butterfly populations, is significant for several reasons. Firstly, it can disrupt ecological balance and lead to the loss of critical ecosystem functions. For example, the decline of butterfly pollinators can reduce the reproduction and diversity of plant species, affecting food webs and the availability of resources for other organisms. Secondly, biodiversity loss can reduce the overall resilience of ecosystems, making them more vulnerable to environmental changes and less able to recover from disturbances. Finally, biodiversity loss can have economic and cultural impacts as well since it affects agricultural productivity, tourism, and human well-being linked to natural environments.

By creating butterfly gardens, we can provide suitable habitats and food sources for butterflies, promoting their population recovery and enhancing biodiversity. These gardens can serve as important stepping stones and corridors for butterflies to move between fragmented habitats. Additionally, butterfly gardens offer an opportunity for education, appreciation of nature, and conservation awareness, helping to inspire individuals to take action in preserving biodiversity.

matching in the picture please help

matching in the picture please help

Answers

Answer:

Explanation:

nucleus is center of atom

proton is positively charged particle in nucleus

electron is negatively charged particle in nucleus

atoms are tiny things that all matter is made up of.

neutron is a neutral particle

molecule is a group of combined atoms

element is a material that is made up of one kind of atom.

radioactive is giving away particles

shell is a level in which electrons orbit .

Design and organise learning experiences according to your local circumstances when teaching Processing (including traditional processing of raw materials; metal processing; food processing)​

Answers

When teaching Processing, it is essential to design and organize learning experiences that align with local circumstances and provide practical applications.

Here is a suggested approach for teaching Processing, including traditional processing of raw materials, metal processing, and food processing, considering local circumstances:

1. Introduction and Contextualization:

Start by introducing the concept of processing and its importance in various industries. Provide examples of local raw materials, metals, and food products that undergo processing. Discuss the significance of processing in the local economy and its impact on society.

2. Field Trips and Industry Visits:

Arrange field trips to local processing facilities such as factories, mills, or food processing plants. These visits offer students firsthand exposure to different processing techniques and machinery. Encourage students to observe and interact with professionals in the field, asking questions and understanding the practical aspects of processing.

3. Hands-on Workshops:

Organize hands-on workshops where students can engage in practical activities related to processing. For example, set up a metalworking workshop where students can learn basic metal processing techniques like cutting, shaping, and welding. Provide guidance on safety measures and proper tool usage.

4. Local Case Studies:

Explore local case studies of successful processing businesses or initiatives. This could involve inviting guest speakers from local processing companies or inviting entrepreneurs who have started their own processing ventures. Students can learn about the challenges, opportunities, and sustainable practices in the local processing industry.

5. Project-Based Learning:

Assign project-based tasks that allow students to apply their knowledge of processing. For example, students could design and develop a prototype for a food processing machine or propose innovative methods to improve traditional processing techniques using local resources. Encourage creativity, critical thinking, and problem-solving skills throughout the project.

6. Community Engagement:

Encourage students to engage with the local community by organizing outreach programs related to processing. This could involve organizing workshops for local artisans or collaborating with local farmers to develop value-added food products. Such activities foster a sense of social responsibility and provide students with real-world experiences.

7. Assessment and Reflection:

Regularly assess student understanding through quizzes, assignments, and presentations. Encourage reflective practices where students can evaluate their own learning journey and identify areas for improvement. Incorporate feedback mechanisms to continuously enhance the learning experiences.

By designing learning experiences that incorporate field trips, hands-on workshops, local case studies, project-based learning, community engagement, and reflective practices, students will develop a holistic understanding of processing and its significance in their local context. This approach will equip them with practical skills, foster creativity, and promote an entrepreneurial mindset, preparing them for future opportunities in the processing industry.

For more questions on Workshops, click on:

https://brainly.com/question/27603871

#SPJ8

The purpose of the study described in the passage was: A.to determine whether LH can modulate GnRH or NPY secretion. B.to determine whether GnRH can modulate NPY secretion. C.to determine whether NPY can modulate LH secretion. D.to determine whether NPY can modulate GnRH secretion.

Answers

Answer:

The correct answer is C) To determine whether NPY can modulate LH secretion.

Explanation:

NPY means Neuropeptide Y while LH means enhances luteinizing hormone.

In the study above, LH is the dependent variable.

Studies have shown that NPY increases LH secretion in part by enhancing the release of LH in response to GnRH. GnRH is an acronym for Gonadotropin-Releasing Hormone.

The above study is a branch of science (Physiology and medicine) which deals with the study of endocrine glands and hormones - Endocrinology.

Cheers!

The purpose of the study described in the passage was: A.to determine whether LH can modulate GnRH or

Describe the similarities and differences between the cheek cell wet mount and dental plaque wet mount.

Answers

Answer:

Cells from the cheek are a type of epithelial cell, similar to skin. ... They can be seen faintly even at 40x (scanning power), but the most dramatic images are at 400x where the nucleus is clearly visible as a dark spot in the center of the cell.

Explanation:

What is the mRNA sequence for this segment of DNA, ACTGACTGACTG?

Answers

Answer:

See below.

Explanation:

DNA-

ACTGACTGACTG

mRNA-

UGACUGACUGAC

-hope it helps

Technology affects the environment in many ways. Which negative impact is NOT due to advances in technology?
A) toxic waste
B) global warming
C) habitat destruction
D) increase in natural disasters

Answers

Answer:

d

Explanation:

Im pretty sure that the answer is d because how could technology cause more NATURAL disasters and also i took the USATestprep

 

Muticellular organisms, cells are organized into tissues, tissues into organs, organs into organ systems, and system into organisms.

Answers

Answer:

Explanation:

.

If a velocity of a car is 20m/s,how much distance cover in 20 second​

Answers

Explanation:

Velocity (V) = 20 m/s

time (t) = 20 sec

distance travelled (d) = ?

We have the formula

V = d / t

20 = d / 20

d = 20 * 20

D = 400 m

The distance covered in 20 sec is 400 m

hope it will help :)❤

Which solution would be better to implement? Justify your answer.

Answers

Better phones have aided individuals in numerous activities, including using them for navigation.

How can one navigate a circumstance?

transitive formalto handle a challenging circumstance well.No one has my complete confidence in navigating these complex political issues.synonyms and words that are similar.

How do you move through a situation?

Observe the bigger picture.As follows:People are considering changing a situation, but they just aren't ready.Preparation: In order to modify a situation, people are arranging and lining up their affairs.Real actions are performed to deal with a novel issue.

To know more about solution implement visit:

https://brainly.com/question/13312818

#SPJ1

Quagga mussels, an invasive species of mollusk originally from
Russia, have been introduced to the lake after being carried in on
the hulls of boats. An assessment of the size of the quagga
mussel problem is needed, along with suggestions to curb their
population growth.
what field of science is this?

Answers

This is a problem in the field of ecology.

The problem of quagga mussels in the lake is an ecological issue that requires scientific assessment and management.

It falls under the discipline of ecology, which studies the relationships between organisms and their environment.

Ecologists investigate the impacts of invasive species on the ecosystem and devise strategies to control their spread and minimize their effects.

In this case, scientists will need to examine the size of the quagga mussel population, their distribution, and their ecological interactions with native species.

They will also need to recommend measures to prevent further introduction of quagga mussels and to manage their population growth, such as using chemical treatments or biological controls.

For more such questions on ecology, click on:

https://brainly.com/question/842527

#SPJ11

is the long-term average weather over a large area

Answers

Climate is the long-term average weather conditions that occur in a particular region. Climate depends on how average weather conditions change throughout the year.

The universal blood donor is A) O+, B) A+, or C) AB-

Answers

O+

because lack antigen A,B, and AB

A zebra and a donkey can successfully mate to produce offspring known as a zonkey. Zonkeys are infertile, display a mixture of donkey and zebra traits, and have a different number of chromosomes from both parent species. Would zonkeys be classified as their own species? Explain with at least one full sentence.

Answers

Zonkeys are the offspring produced from a cross between a zebra and a donkey. These are classified as a separate species as it shows characteristic

What are Zonkeys?

A zonkey is a offspring produced from the cross between a zebra and a donkey. Donkeys are closely related to zebras and both of these animals belong to the horse family.

Zonkeys are the used as beasts of burden (work animals) because of their great strength and stamina to hold heavy weights. It is also believed that they inherit resistance to some pests and diseases as well from their zebra fathers. Some zoos also use them to offer rides to the public.

Learn more about Zonkeys here:

https://brainly.com/question/2292229

#SPJ1

Which property is shared by the cells of all living things?

A. The cells contain DNA composed of adenine, thymine, guanine, and cytosine.

B. The cells have chromosomes that are located inside a membrane-bound- nucleus.

C. The cells are surrounded by a phospholipid bilayer and a cell wall made of
cellulose.

D. The cells rely on mitochondria to carry out aerobic cellular respiration.

Answers

Answer:

A

Explanation:

B) not all cells have a nucleus. For example, prokaryotes have no nucleus

C)Not all cells have a cell wall.(Animal cells don't)

D) not all cells have mitochondria (Prokaryotes don't)

A) all cells contain DNA, and DNA is all composed of adenine, thymine, guanine, and cytosine.

Living things are those organisms that have life and they possess the basic characteristics that enable them to be termed as living. This include growth, reproduction, irritability etc.

The property listed in the options shared by cells of all living things is the cell contain DNA composed of adenine, thymine, guanine and cytosine.

All living things contain the genetic material (DNA) that carry the needed information essential for their cells to function. Although some living things do not have a membrane bound nucleus eg prokaryotic cells. Many differences therefore exists that differentiates the living things from one another bringing them into groups.

Learn more: https://brainly.com/question/18628083

MULTIPLE CHOICE QUESTION
Some cell types divide more often than other cell
types.
False
True

Answers

False some soul types do not divide more often than other cells

Type at least 3 adaptions they have and explain how these adaptions help them survive in their environments

Type at least 3 adaptions they have and explain how these adaptions help them survive in their environments

Answers

The head and limbs are protected from harm by thick scales. For gripping and tearing grass and other food sources, a sharp, beak-like mouth is helpful. Box turtles can evade predators thanks to their camouflaged carapace.

What adaptations does the box turtle have?

The distinctive color of box turtles is one adaption that helps them blend in with the moist ground, discarded leaves, and other litter on the forest floor. Its plastron is dark brown.

This bilobed plastron, which is present in all box turtles, enables them to close their shell. They hardly ever leave their native area if their habitat offers enough food, water, shelter, and opportunities for social interaction with other box turtles.

To know more about box turtle, refer

https://brainly.com/question/20462260

#SPJ1

How does an increased population size affect the amount of competition between organisms?

Answers

Competition will increased because more organisms will be competing for resources

Please Help!!!
How many ATP can be obtained from the complete beta-oxidation and metabolism of one 16-carbon fatty acid molecule?​

Answers

Answer:

read ex

Explanation:

129 ATP

can you heat alcohol over an open flame. Give reason for your answer​

Answers

Answer:

No, you cannot. The problem is that alcohol fumes are flammable. If you heat over an open flame you risk igniting the fumes which will start a chain reactions.

Explanation:

ggl and knowledge

Brown marmorated stink bugs are native to China and Japan. They were identified in Pennsylvania for the first time in 1998 and have since spread across North America, feeding on agricultural crops. Which of the following characteristics of the brown marmorated stink bug has led to them being an invasive species in North America?
A. They reach maturity slowly.
B. They are tolerant of a wide range of environmental conditions.
C. They are often eaten by native wasps and birds.
D. They have only a few surviving offspring each year.

Answers

The right response is B. They can withstand a variety of environmental factors.

How many species of bugs are there?

Insects represent the most varied category of creatures, meaning that there are more species of them than any other group, it has long been acknowledged and documented. There are an estimated 900,000 different species of live insects in the globe. This illustration roughly represents 80% of all species.

Which insects are called bugs?

Insects of the class Insecta, which include bugs, have three parts to their bodies, often two pairs of wings and three pairs of legs. Spiders, ticks, centipedes, and other arthropods belong to a different phylum than bugs and insects.

To know more about bugs visit:

brainly.com/question/27344631

#SPJ1

Other Questions
A local business in Toronto, Canada, has a reputation for offering a spectacularcustomer journey, regardless of whether purchases are made online or in their brick-and-mortar shop. In this context, what does the term 'customer journey' refer to? Consider the incomplete paragraph proof.Given: P is a point on the perpendicular bisector, I, ofMNProve: PM = PNK8Because of the unique line postulate, we can drawunique line segment PM. Using the definition ofreflection, PM can be reflected over line / By thedefinition of reflection, point P is the image of itself andpoint N is the image ofBecause reflectionspreserve length, PM = PN The consequences of low birthweight have been established by longitudinal research. this type of research? Research organizer for Greta Thunberg An experimenter finds that standing waves on a string fixed at both ends occur at 12 Hz and 16 Hz , but at no frequencies in between. What is the fundamental frequency? during her speech, caren keeps her hands at her sides, even when shes talking about the part's shes most excited about. Which quality of her speech most needs improvement. In one or two paragraphs, explain to me how the Legislative branch works with the Executive branch. You can use an example of a current event, or explain it according to what the Constitution says. PLEASE ANSWER ASAP, THIS IS DUE TOMORROW AND I HAVE NO CLUE WHAT TO SAY- 50 POINTS PLEASEEEEEEEEEEEE HELPPPPPPPPPPP Plant leaves contain small openings called blank______, through which carbon dioxide, one of the requirements for photosynthesis, enters the plant. A heater on the first floor of the school makes the air on the second floor warm.what is it conduction convection or radiation TRUE / FALSE. real estate refers to the physical land and improvements constructed on the land. please help !! hint : Do NOT divide the time by the distance explain how a defibrillator uses a capacitor to deliver a strong electric current over a very short amount of time. Think of what happens during the process from the defibrillator being taken from its case to the moment when the electric shock is applied. Why do you think that a capacitor is needed for this process rather than a battery, which also is designed to store charge among the roles that superior team leaders perform, _____ involves seeking information from managers, peers, and specialists, and investigating problems systematically. 4. The following statements describe the performance of Japanese music, EXCEPT ONE a. Japanese music is highly ritualized, as much in the music itself, as in the composure of the musicians when perla b. Traditional Japanese music is basically meditative in character. C. The performance of Japanese music has traditionally been of a spintual character.d. Japanese music implies more on lively and more energetic. Find the area of the square? A nurse is caring for an older adult client who is at risk for developing pressure ulcers. Which of the following interventions should the nurse use to help maintain the integrity of the client's skin? (Select all that apply)a) Keep the head of the bed elevated at 30 degrees.b) Massage the client's bony prominences frequently.c) Apply cornstarch liberally to the skin after bathing.d) Have the client sit on a gel cushion when in a chair.e) Reposition the client at least every 3 hours while in bed. What is it called when artists look to other cultures for inspiration? What issues could arise from this practice? >M12-LCMT-F D02.ab1CATGAATATTGTACGGTACCATAAA>M13-LCMT-F E02.ab1CATGAATATTGCACGGTACCATAAA >M14-LCMT-F F02.ab1CATGAATATTGTACGGTACCATAAA125 >M15-LCMT-F G02.ab1CATGAATATTGCACGGTACCATAAA ->M16-LCMT-F_H02.ab1CATGAATATTGTACGGTACCATAAA >M12-LCMT-F_D02.ab1TACTTGACCACCTGTAGTACATAAA M13-LCMT-F_E02.ab1TACTTGACCACCTGTAGTACATAAA >M14-LCMT-F_F02.ab1TACTTGACCACCTGTAGTACATAAA150 >M15-LCMT-F_G02.ab1TACTTGACCACCTGTAGTACATAAA>M16-LCMT-F_H02.ab1TACTTGACCACCTGTAGTACATAAA >M12-LCMT-F_D02.ab1AACCCAATCCACATCAAAACCCCCT >M13-LCMT-F_E02.ab1AACCCAATCCACATCAAAACCCCCT >M14-LCMT-F_F02.ab1AACCCAATCCATATCAAAACCCCCT175 >M15-LCMT-F_G02.ab1AACCCAATCCACATCAAAACCCTCC >M16-LCMT-F_H02.ab1AACCCAATCCACATCAAAACCCCCT >M12-LCMT-F_D02.ab1CCCCATGCTTACAAGCAAGTACAGC >M13-LCMT-F_E02.ab1CCCCATGCTTACAAGCAAGTACAGC >M14-LCMT-F_F02.ab1CCCCATGCTTACAAGCAAGTACAGC200 >M15-LCMT-F_G02.ab1CCCCATGCTTACAAGCAAGTACAGC >M16-LCMT-F H02.ab1CCCCATGCTTACAAGCAAGTACAGOcan you please compare the DNA sequences in this image, mark any insertion, deletion, polymorphism, and addition. Discuss about the yellow region in sequences and the nucleotides. discuss all the similarities and differences. I need a detailed description True or false. Atoms of a given element will have the same mass. BBall Player A chose as a goal to be abstinent untilhe got married to benefit his personal life + hechose to work hard to get into the NBA to fulfill aprofessional dream.BBall Player B chose to chase his professional dreamto make it into the NBA and worked hard to fulfillthat goal.What happened to these two basketball players?