Answer:
D.
Explanation:
In humans when the haploid sperm and egg cell join in fertilisation the resulting zygote has a total of 46 chromosomes the correct number to develop. By having gametes which are haploid, when the gametes combine, diploid cells are maintained.
In the early days of germ theory, contagious diseases were thought to be caused only by fungi or bacteria. In the 1890s, Dmitri Ivanovski filtered extracts from diseased tobacco plants and discovered that the disease could be transmitted to new plants through the filtrate. He hypothesized that something smaller than bacteria or fungi was responsible for the transmission of the disease. Which best explains how Ivanovski's work led to a change in the germ theory? He tried to promote his hypothesis as a law. He used a new experimental method to test his hypothesis. He used a more powerful bacterial strain than other scientists had. He obtained results that confirmed what other scientists were thinking.
Answer:
He used a new experimental method to test his hypothesis.
Explanation:
Dmitri Ivanovski, a Russian microbiologist who was born in the year 1864 and died in 1920. He was the scientist who initiated the discovery of viruses as a pathogenic microorganism. He worked to discover the cause of mosaic disease in tobacco plant and he hypothesized that that something smaller than bacteria or fungi, as early believed, was responsible for the transmission of the disease.
In order to test his hypothesis, he passed a solution containing the causative agent of the disease, which he prepared from the infected plant leaves, through a filter known as Chamberland filter. He was able to discover that the filtrate still contained microbial pathogens that can infect more tobacco plants, confirming his hypothesis that something smaller than fungi or bacteria is responsible for the tobacco mosaic infection.
Hence, to test out his hypothesis, Ivanovski in the 1890's used a new experimental method i.e. CHAMBERLAND FILTER method.
when the chromosomes are aligned at the middle of the cell during
What is the order from least complex to most complex?
Answer:
Explanation:
The major levels of organization in the body, from the simplest to the most complex are: atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism.
Do you think these fish are an example of natural selection among two populations of the same species? Explain your answer.
Answer:
It depends on the fish (I do not see any pictures) Any fish is an example of natural selection.
Explanation:
A good example would be that polar bears grew and evolved to have white fur to blend in the snow to sneak upon prey. However, their brown bear counterparts failed to do that. So due to better camouflage and hunting technique, the polar bears survived more up north.
Answer:
The two fish are of the same species because they can mate with each other. Also, the characteristics of the blind cave fish enable them to live in caves. Eyes need energy. So, developing bodies with no eyes allowed these fish to function more efficiently.
Explanation:
PLEASE QUICK!!!!
Complete the analogy
Cells : _______ :: Species : Population
Answer:
There are more but there is only one blank so,
The answer should be Organism (?)
Please help!
1. RNA contains____, which replaces___ in DNA
a. Adenine, cytosine
b. uracil, thymine
c. thymine, adenine
d. guanine, cytosine
2. Which of the following are involved in protein synthesis?
a. transfer RNA only
b. messenger RNA only
c. ribosomal RNA and transfer RNA only
d. messenger RNA, ribosomal RNA, and transfer RNA
3. Which pf the following makes a copy of DNA to serve as the pattern for genetic code and protein synthesis?
a. rRNA
b. tRNA
c. mRNA
d. RNA polymerase
4. Which sugar is present in the structure of RNA?
a. ribose
b. deoxyribose
c. glucose
d. lactose
5. What is the product of transcription?
a. RNA molecules
b. DNA molecules
c. RNA polymerase
d. proteins
6. Use the codon chart above to determine the amino acid produced from the RNA Codon of UCA.
a. leucine
b. Proline
c. tyrosine
d. serine
7. What occurs during the translation process?
a. Messenger RNA is made from DNA.
b. The cell uses information from messenger RNA to produce proteins.
c. Transfer RNA is made from messenger RNA
d. Copies of DNA molecules are made.
8. Genes contain the keys for constructing
a. purines
b. nucleosomes
c. proteins
d. pyrimidines
9. Which of the following is a point mutation?
a. A mutation involving a segment of a chromosome
b. A mutation involving the addition of one or more nucleotides into a segment of DNA
c. A mutation involving a single nucleotide
d. A mutation involving one chromosome breaking off and attaching to a different chromosome
10. According to the figure above, what codon represents the amino acid Arginine?
a. AAG
b. CGC
c. UUU
d. CCC
11. Which of these is a nucleotide found in RNA?
a. ribose + phosphate group + thymine
b. ribose + phosphate group + uracil
c. deoxyribose + phosphate group + uracil
d. deoxyribose + phosphate group + cytosine
12. DNA replication results in two DNA molecules.
a. each with two new strands.
b. one with two new strands and the other with two original strands.
c. each with one new strand and one original strand.
d. each with two original strands.
13. Figure 1 below shows the structure of a (an)
a. DNA molecule.
b. amino acid.
c. RNA molecule.
d. protein.
14. DNA is copied during an action called
a. replication
b. translation
c. transcription
d. transformation
15. What is the mRNA sequence that will be formed from the DNA sequence below?
TAC CGG ATG CCA GAT CAA ATC
Answer:
RNA contains uracil, which replaces in thymine in DNA. mRNA (messenger RNA), rRNA (ribosomal RNA), and transfer RNA (tRNA) is involved in the process of protein synthesis. Thus, the correct options for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14 are B, D, C, A, A, D, B, C, C, B, B, C, B, and A, respectively.
What are Nucleic acids?Nucleic acids are the biomolecules which are made up of nucleotide units and these contain genetic information of the cell in the form of long chains of DNA molecules.
In RNA, uracil is present and it is replaced with thymine in DNA.
In the process of protein synthesis, messenger RNA, ribosomal RNA, and transfer RNA are involved.
mRNA makes a copy of the DNA to serve as the pattern for genetic code and protein synthesis in the cell.
Ribose sugar is present in the RNA molecule and deoxyribose sugar is present in the DNA molecules.
RNA molecules are the product of transcription and proteins are the product of translation.
From the codon chart, the RNA codon of UCA determines the amino acid serine.
Translation is the process during which the cell uses the information from mRNA (messenger RNA) to produce proteins.
Genes contain the keys for the construction of proteins in the ribosome of the cell.
A point mutation involves the change at a single nucleotide site in the DNA molecule.
Arginine amino acid can be represented by the codon CGC as per the codon chart given in the question.
RNA (ribonucleic acid) is made up of ribose sugar, phosphate group and the uracil base.
DNA replication results in two DNA molecules with each containing one new strand and one original strand.
Figure 1 given below in the question shows the structure of amino acids.
DNA is copied during an action process called as replication.
The mRNA sequence which will be formed from the DNA sequence "TACCGGATGCCAGATCAAATC" is "AUGGCCUACGGUCUAGUUUAG".
Therefore, the correct options for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14 are B, D, C, A, A, D, B, C, C, B, B, C, B, and A, respectively.
Learn more about Nucleic acids here:
https://brainly.com/question/11309892
#SPJ1
You compare homologous nucleotide sequences among several pairs of species with known divergence times. A pair of species that diverged 1 million years ago has two nucleotide differences, a pair that diverged 2 million years ago has four nucleotide differences, and a pair that diverged 3 million years ago has six nucleotide differences. You have sequence data for another pair of species for which the divergence time is unknown. There are five nucleotide differences between them. Based on your clock, when did their line of ancestry diverge?
A. 3.5 million years ago
B. 2 million years ago
C. 3 million years ago
D. 2.5 million years ago
Answer:
Option D, 2.5 million years ago
Explanation:
Given
Pair of species that diverged 2 million years ago has four nucleotide differences
Pair of species that diverged 3 million years ago has six nucleotide differences
A pair of species X has diverged Y million years ago and has five nucleotide differences
These facts clearly indicate that the pair of species X has diverged between the 2 and 3 million years ago as 2 million year ago there was four nucleotide differences and 3 million years ago there was six nucleotide differences. Hence, 5 nucleotide differences would occur in pair of species that diverged between 2 and 3 million years ago.
Thus, option D is correct
Who first came up with the idea that the universe began with a big bang?
Answer:
The answer to your question is Georges Lemaître.
what surfaces or objects on earth would reflect infrared light well?
Answer:
Infrared, sometimes called infrared light, is electromagnetic radiation with wavelengths longer than those of visible light. It is therefore invisible to the human eye.
Aside from water vapor, bodies of water on the surface of the Earth also absorb IR wavelengths well. Glass, wood, brick, stone, asphalt and paper all absorb IR radiation. While regular silver-backed mirrors reflect visible light waves, allowing you to see your reflection, they absorb infrared radiation.
ntercropping and crop rotation both ________. Group of answer choices are prohibited in organic farming are aspects of IPM are techniques for conserving soil resources and fertility contribute to leaching contribute to erosion and desertification
Both intercropping and crop rotation both contribute to conserving soil resources and fertility in agriculture.
Intercropping involves growing two or more different crops together in the same field simultaneously. This practice helps maximize the use of resources such as sunlight, water, and nutrients, as different crops have different growth requirements. By diversifying the plant species in the field, intercropping can enhance soil nutrient cycling, reduce pest and disease pressure, and improve overall soil health.
Crop rotation, on the other hand, involves systematically changing the type of crops grown in a field over time. This practice helps break pest and disease cycles, improves soil structure, and prevents nutrient depletion. Different crops have varying nutrient demands and root systems, which can benefit the soil by replenishing nutrients, reducing soil-borne pathogens, and promoting soil biodiversity.
Both intercropping and crop rotation are sustainable agricultural practices that contribute to the long-term health and productivity of the soil, thereby conserving soil resources and fertility. These practices are widely used in various agricultural systems, including organic farming and integrated pest management (IPM).
To learn more about crop rotation, here
https://brainly.com/question/30172802
#SPJ4
Considering that the 2006 median U.S. salary for a dual-income household is $58 472 (U.S. CensusBureau), how much would you be spending on water (if you spent the same percentage of your income as the people of Cochabamba? What would be your reaction if this happened to you?
If I spent the same percentage of my income on water as the people of Cochabamba, I would be spending about $5847.20 per year.
How to explain the informationThis is a significant amount of money, and it would be a hardship for me to afford. I would have to make some difficult choices about how to spend my money, and I would probably have to cut back on other expenses.
If this happened to me, I would be very upset. I would feel like I was being taken advantage of, and that my basic needs were not being met. I would also be concerned about the impact that this would have on my family and my health.
Water is a basic human right, and it is unacceptable that people have to pay such high prices for it. I would do everything I could to fight back against this injustice, and I would encourage others to do the same.
Learn more about water on
https://brainly.com/question/30909861
#SPJ1
I got 2 and 4 wrong on my quiz and failed? These were the same exact questions. I don't know why...
Answer:
I'd uhh cycfuvuvuvuvyvuvuuvuvv
What would be the most likely effect if several species of carnivores are removed from an ecosystem?
A. a decrease in community stability
B. an increase in species diversity
C. an increase in plant life
D. a decrease in the number of natural disasters
Answer:
A species of bacteria is antibiotic resistant. Out of 300 bacteria, 210 reproduce with this mutation. What percentage of the resistant bacteria successfully reproduced? answer in percent
Explanation:
HURRY I'M DESPERATE
What is sustainable development?
Answer:
Sustainable development is an organizing principle for meeting human development goals while simultaneously sustaining the ability of natural systems to provide the natural resources and ecosystem services on which the economy and society depend on.
Explanation:
3. What is one thing that can be done to help improve areas that produce a lot of runoff?
Answer: hi, im here to help :3
so, you can either use plants, use pesticides and fertilizers less often or the one thing i know is consider a rain barrel.
into which chamber of the heart will blood flow next after the vessel indicated by the red arrow? into which chamber of the heart will blood flow next after the vessel indicated by the red arrow? left ventricle right atrium left atrium right ventricle
The blood flow through the heart, and you can determine the chamber based on the red arrow in your diagram. Blood flows through the heart in the following order.
1. Deoxygenated blood enters the right atrium from the superior and inferior vena cava.
2. Blood flows from the right atrium to the right ventricle through the tricuspid valve.
3. Right ventricle pumps the blood to the lungs for oxygenation via the pulmonary artery (pulmonary circulation).
4. Oxygenated blood returns to the heart through the pulmonary veins and enters the left atrium.
5. Blood flows from the left atrium to the left ventricle through the bicuspid (mitral) valve.
6. Left ventricle pumps the oxygenated blood to the rest of the body via the aorta (systemic circulation).
Considering the options you provided (left ventricle, right atrium, left atrium, right ventricle), identify the vessel in your diagram with the red arrow and use the steps above to determine which chamber the blood will flow into next.
To know more about right ventricle visit:
https://brainly.com/question/29830374
#SPJ11
Most of the energy that heats the troposphere is
A Conduction
B Convection
C Radiation
D None of the above
Answer:
B. Convection
Explanation:
most of heat energy transferred in the troposphere is done by convection. Convection does not only mean thunderstorm clouds but means any mixing of air. Air is always on the move (rising, sinking and advecting). The air mixes as it moves into the surrounding air.
Answer:
Convection would be the correct answer.
Which statement is true about scientific theories and laws? A. A theory can never become a law. B. If enough evidence is found for theory, it will become a law. C. Theories have more proof than laws. D. Only laws are widely accepted by the scientific community.
Answer:
. Only laws are widely accepted by the scientific community.
A factory employee spends two hours putting together a car part. A machine can do the same job in thirty minutes. Which statement best describes the time-effectiveness of this scenario? A. The employee is four times as time-effective as the machine. B. The machine is half as time-effective as the employee. C. D. The employee is half as time effective as the machine. E. The machine is four times as time-effective as the employee
Answer:The machine is four times as time-effective as the employee.
Explanation:
Answer:
The machine is four times as time-effective as the employee.
Explanation:
on edge
A collision between which two types of crust will most likely produce a mountain range?
Answer:
Be more specific
Explanation:
Answer:
A convergent boundary
Explanation:
Convergent boundaries are pieces of crust that collide against each other. They push upwards, and that land that is pushed upwards is a mountain. Mount Everest is a good example. It was made in two tectonic plates, and since these plates are still pushing upwards to this day, this mountain grows around 40 cm each year. I hope this helps!
How can ocean pollution be controlled?
Answer:
You could start a group and pick up trash from the ocean and inform people that if we throw trash in the ocean sea animals can die and the ocean will be dirty and one day we will have no water left to drink if all water is dirty
Explanation:
No explanation
PLEASE HELP ASAP!!
1) Complete the diagram of the cell cycle by writing the names of
each of the four phases.
Answer: Verified by: imsobored100013
Explanation: There's no explanation for this answer if need of help just reply to this answer.
Hope this helped you :)
There are four phases in the cell cycle. Thus, the four phases are the G1 phase, S phase, G2 phase, and M phase.
What is the cell cycle?Chromosomes and other cell components duplicate to create two copies of themselves over the course of the cell cycle. Following this, the cell divides into two daughter cells, distributing one copy of the duplicated material to each.
G1, S, G2, and M are the four distinct stages of the cell cycle. DNA replication takes place during the S or synthesis phase, and the cell divides during the M or mitotic phase. The other two phases, G1 and G2, sometimes known as the "gap phases," are equally significant but less striking. Further M phase is divided into prophase, metaphase, anaphase, and telophase.
Thus, the G1 phase, S phase, G2 phase, and M phase are the four main phases in a cell cycle.
Learn more about the cell cycle, here:
https://brainly.com/question/29768998
#SPJ2
Ribosomal RNA is also known as rRNA
and is located on the ribosome.
Which of these is TRUE about rRNA?
A. It helps mRNA move along the ribosome.
B. It creates extra cytoplasm.
C. It unzips DNA strands.
D. It takes DNA outside the nucleus.
The ribosome is where ribosomal RNA, commonly known as rRNA, is found. Strands of DNA are unzipped.
Where can one locate ribosomal RNA?80% of the total RNA in a cell is made up of rRNAs, which are located in ribosomes. The 50S subunit, which is a substantial component of ribosomes, and the 30S subunit, which is a smaller component, are each made up of unique rRNA molecules.
What does ribosomal RNA gene mean?an RNA ribosome All living things need ribosomal ribonucleic acid (rRNA), which is the RNA component of the ribosome and crucial for protein synthesis. About 60% of the ribosome's mass is made up of rRNA, and the remaining 40% is made up of protein.
To know more about Ribosomal RNA visit:-
https://brainly.com/question/12878512
#SPJ1
Answer: It helps mRNA move along the ribosome
Explanation:
1. What are two of the evidence-based ways that solar parks can be modified to protect and enhance pollinator biodiversity, according to these researchers?
According to researchers, there are two evidence-based ways to modify solar parks to protect and enhance pollinator biodiversity.
The first method involves incorporating native flowering plants within the solar panel arrays. This provides a habitat for pollinators such as bees and butterflies, increasing their numbers
. The second method involves reducing the frequency of mowing or maintenance in the areas surrounding the solar panels.
This allows for the growth of natural vegetation, which provides a food source for pollinators and also creates a more natural habitat. Both of these modifications have been shown to positively impact pollinator biodiversity in solar parks, making them more environmentally sustainable.
Learn more about Solar panel at
https://brainly.com/question/28458069
#SPJ11
can someone read this and tell me if it makes sense?
question 1 which situation fits the fmri scan of this brain? social anxiety sleeping listening to music walking down the street to class
The situation that fits the fMRI scan of this brain is social anxiety. Thus, Option A holds the truth.
An fMRI scan (Functional Magnetic Resonance Imaging) is a type of brain imaging technique that measures brain activity by detecting changes in blood flow. It is used to study the brain's functional organization and how different areas of the brain are involved in different tasks.
In the case of social anxiety, fMRI scans have shown that there is increased activity in the amygdala, which is the part of the brain that is involved in fear and anxiety. Therefore, the situation that fits the fMRI scan of this brain is social anxiety, as it would show increased activity in the amygdala compared to the other situations mentioned.
Learn more about fMRI scan https://brainly.com/question/19340373
#SPJ11
Please Help!
1. Name any two of the major types of chemical substances that are broken down in chemical digestion. For each substance, name an enzyme that breaks them down and what final product is actually absorbed by the body for use or storage.
2. Why does the GI tract have a plexus in the muscalaris and nerves in the mucosa? What physiological functions of the tract are supported by these anatomical structures? Think about your answer in the context of Hirschsprung’s disease, a congenital disorder of the colon that involves a defect in the myenteric plexus. What symptom or problem do you imagine the disease would cause?
Explanation:
let me attempt to answer your questions.
1. a.Carbohydrates. They are broken down by several enzymes; ptyalin converts cooked starch to maltose and maltase converts maltose to glucose,which is used by the body cells to produce energy in the form of ATP and it's excess is stored as glycogen in the liver
b. Proteins. Pepsin converts proteins to peptides,rennin converts caseinogen to casein. Trypsin also converts proteins to peptides. Erepsin converts peptides to amino acids which are used by the body. Proteins also yield energy for the body ie. 4kcal per gram
2. The GI tract has a plexus in the muscularis so that there can be a localized control of gastrointestinal motility ie. the myenteric plexus of the muscularis alongside the Meissner plexus of the submucosa form the enteric nervous system. This is to say that the physiological function supported by these anatomical features is gastrointestinal motility. Hirschsprung disease or megacolon causes low GI motility
After Frida stops exercising, she continues to breathe heavily. What is most likely occurring in her body?
a. Heavy breathing during exercise has produced an oxygen surplus in her muscles. This oxygen is being transported to her lungs. This is a result of aerobic respiration.
b. Heavy breathing during exercise has produced a carbon dioxide surplus in her muscles. Lactate is being transported to her liver. This is a result of aerobic respiration.
c. Strenuous exercise has caused her body to be in carbon dioxide debt, and she is breathing hard while lactate is transported to the liver. This is a result of anaerobic respiration.
d. Strenuous exercise has caused her body to be in oxygen debt, and she is breathing hard while lactate is transported to the liver. This is a result of anaerobic respiration.
Answer:
D. Strenuous exercise has caused her body to be in oxygen debt, and she is breathing hard while lactate is transported to the liver. This is a result of anaerobic respiration.
Explanation:
Please Mark me brainliest
Why biology is important for the welfare of human beings?Give reasons
Answer:
as the field of science, biology help as to understand the living world and the ways it's many species
what's differences anaerobic vs aerobic
Answer:
Anaerobic means no oxygen
Aerobic means oxygen
Explanation: