Rhizobia, a type of nitrogen-fixing soil bacteria, and legumes can coexist together.
What can you say about bacteria in one sentence?a huge collection of single-cell organisms. Some affect both humans and animals with infections and diseases. Some bacteria aid in the digestion of food, assist the body produce necessary vitamins, and eliminate disease-causing cells. Additionally, bacteria are employed to create nutritious foods like yogurt. But contagious microorganisms can give you a disease.
What is the genesis of bacteria?Bacteria are found in hot springs, polar ice and glaciers, soil, water, plants, wildlife, radioactivity, and deep inside the earth's crust. Bacteria can be found in the stratosphere, from 6 and 30 miles high in the atmosphere, as well as in the deepest parts of the ocean, 10,000 meters or 32,800 feet below the surface.
To know more about bacteria visit:
https://brainly.com/question/8008968
#SPJ4
In a wheel and axel,the radius of the wheel is 50cm and that of the axel is 20 cm.if a load is 2000n is lifted by applying an effort of 1000n,calculate ma,vr and
The value of actual machine advantage (MA) is 2, velocity ration (VR) is 2.5 and efficiency η is 80%.
Calculation:
It is given that the radius of the wheel is 50 cm, radius of axle is 20 cm, load is 2000 N and effort is 1000 N.
Let, R = 50 cm
r = 20 cm
L= 2000 N
E = 1000 N
We have to calculate actual machine advantage, velocity ratio and efficiency.
We know that,
Actual machine advantage is the ratio of load and effort.MA=L/E
=2000/1000
=2
Velocity ratio is obtained by the ratio of radius of wheel to the radius of axle.VR=R/r
=50/20
=2.5
Efficiency is the percentage of the ratio of actual advantage and velocity ration.η=(MA/VR)*100
=(2/2.5)*100
=(0.8)*100
=80%
Since your question is incomplete, your complete question might be
"In a wheel and axel, the radius of the wheel is 50cm and that of the axel is 20 cm. If a load is 2000n is lifted by applying an effort of 1000n,calculate ma, vr and η."
Learn more about simple machine here,
https://brainly.com/question/18883736
#SPJ4
You are a lab researcher and are investigating the effects of a newly developed drug. You find that the drug destroys mitochondria. How might (or might not) this drug affect the Na+/K+ ATPase?
If a newly developed drug destroys mitochondria, it may impact the Na+/K+ ATPase since the ATPase's ability to function is reliant on mitochondrial function.
Mitochondria are known as the powerhouse of the cell and are involved in ATP production, a critical energy source for cellular activities. Na+/K+ ATPase, which is a transmembrane protein, is involved in maintaining the cellular concentration of sodium and potassium ions. The pump hydrolyzes ATP to transfer sodium out of the cell and potassium into the cell, hence allowing proper nerve and muscle function.
Due to this, the destruction of mitochondria would adversely affect the Na+/K+ ATPase's function since the ATPase's capacity to function relies heavily on mitochondrial function. As a result, the newly developed drug's destruction of mitochondria may disrupt the Na+/K+ ATPase, thereby impacting cellular physiology.
Learn more about mitochondria here:
https://brainly.com/question/14740753
#SPJ11
HELP ME PLEASE Which equation shows one way that a plant cell stores energy in an energy-carrier molecule?
Note that the equation that shows how cells use the energy stored in an energy carrier is as follows: ATP → ADP + NADPH (option D).
In the cell, how is energy used?Energy is the ability to do labor and is a critical criteria for every metabolic activity that happens in living cells.
Adenosine triphosphate is the energy currency in living creatures' cells (ATP). ATP is a biomolecule that provides energy in cellular processes.
When a phosphate group is added to ADP, energy is stored in the cell, whereas energy is discharged for use when a phosphate group is removed from ATP to create ADP.
This implies that the equation that depicts how cells utilise the energy contained in an energy carrier is: ATP ADP + NADPH.
Learn more about energy carrier at:
https://brainly.com/question/14275887
#SPJ1
Explain the different ways to explain the concentration of a solute in solution.
Answer:
When discussing the concentration of a solute in a solution, there are several ways to express it. The choice of method depends on the specific requirements of the situation and the nature of the solute and solvent involved. Here are some common ways to express solute concentration:
Molarity (M): Molarity is one of the most frequently used units of concentration. It represents the number of moles of solute dissolved in one liter of solution. Molarity (M) is calculated by dividing the moles of solute by the volume of the solution in liters.
Molality (m): Molality is similar to molarity, but it expresses the concentration of the solute in terms of the number of moles of solute per kilogram of solvent. Molality (m) is calculated by dividing the moles of solute by the mass of the solvent in kilograms.
Mass percent (% m/m): Mass percent is a ratio of the mass of the solute to the total mass of the solution, expressed as a percentage. It is calculated by dividing the mass of the solute by the mass of the solution and multiplying by 100.
Volume percent (% v/v): Volume percent is similar to mass percent, but it represents the ratio of the volume of the solute to the total volume of the solution, expressed as a percentage. It is calculated by dividing the volume of the solute by the volume of the solution and multiplying by 100.
Parts per million (ppm) and parts per billion (ppb): These units are used when the solute concentration is extremely low. Parts per million represents the ratio of the number of moles of solute to one million moles of solution, while parts per billion represents the ratio of the number of moles of solute to one billion moles of solution.
Normality (N): Normality is a concentration unit that takes into account the chemical reactivity of the solute. It represents the number of equivalents of solute per liter of solution, where an equivalent is a measure of the solute's ability to undergo a chemical reaction.
It's important to note that these concentration units may vary depending on the field of study or specific application. Choosing the appropriate unit is crucial for accurate communication and analysis in the context of solute concentration.
Explanation:
What is the term that describes how sharks have babies?
i need help with this
Answer:
Viviparity
Explanation:
What is the name of a species that is the first species to colonize an
area?
Select one:
a. Frontier species
b. Pioneer species
c. Explorer species
d. Pilgrim species
Answer:The answer is b. Pioneer species
Step-by-step explanation; The first species to colonize an area after a major disturbance are called pioneer species; they help to form the new environment. Secondary succession occurs after a disturbance such as a forest fire, where there is still some organic matter to allow new plants to grow.
If a strand of mRNA has the sequence GCU-AGU, what are the amino acids that correspond to that sequence
The sequence GCU-AGU on a strand of mRNA codes for the amino acids alanine and serine.
If a strand of mRNA has the sequence GCU-AGU, the corresponding amino acids can be determined using the genetic code. Here's the step-by-step explanation:
1. Divide the mRNA sequence into the individual codons: GCU and AGU.
2. Refer to the genetic code to find the amino acids that corresponding to each codon:
- GCU codes for Alanine (Ala or A)
- AGU codes for Serine (Ser or S)
So, the amino acids that correspond to the mRNA sequence GCU-AGU are the Alanine and Serine.
Learn more about amino acids here: brainly.com/question/28409615
#SPJ11
endosymbiont theory is supported by the fact that certain organelles have their own dna. true false
False. The endosymbiont theory is supported by the discovery that certain organelles within eukaryotic cells, such as mitochondria and chloroplasts, that were engulfed and absorbed by their host cells through a process called endocytosis.
Over time, these engulfed prokaryotes evolved to become dependent on their host cells for survival, and eventually became integrated into the host's cellular structure as specialized organelles. The endosymbiont theory explains how these organelles evolved to become integrated within eukaryotic cells and how they continue to play important roles in cellular metabolism and energy production.
However, the fact that certain organelles have their own DNA is not directly related to the endosymbiont theory. While it is true that the DNA of organelles such as mitochondria and chloroplasts is distinct from that of their host cells, this is not necessarily evidence of an endosymbiotic origin. It is possible that these organelles originated through other mechanisms, such as horizontal gene transfer or direct fusion of cells.
Learn more about endosymbiont visit: brainly.com/question/1698852
#SPJ4
which is not part of the process of initiation of replication at oric?
The initiation of replication at oric occurs with the help of the DnaA protein. It has been reported that it is an essential process in bacteria, and it is associated with the DNA replication initiation process.
In the initiation of replication, DnaA protein binds to DnaA boxes of the oriC region, after which the melting of the DNA strands begins.During this initiation process, various proteins participate, which are as follows:DNAA protein - It is essential in the initiation process and helps in the binding of the protein with the dnaA box and the DNA's melting.DNAB protein - It is a helicase enzyme that is responsible for the unwinding of the DNA double helix.DNAC protein - DNAC protein is a subunit of the DnaB helicase enzyme.
DNAG protein - DNAG protein is an enzyme that helps in the synthesis of DNA.The process of initiation of replication at oric requires four different types of proteins. The above-provided proteins are necessary for the initiation of replication at oric. Therefore, there is no such protein which is not part of the process of initiation of replication at oric.
To know more about DNA replication visit:-
https://brainly.com/question/30111562
#SPJ11
Explain why it is important to create experiments that are reproducable by other people.
Answer:
Reproducibility is important because it is the only thing that an investigator can guarantee about a study. Contrary to what most press releases would have you believe, an investigator cannot guarantee that the claims made in a study are correct (unless they are purely descriptive) So reproducibility is important not because it ensures that the results are correct, but rather because it ensures transparency and gives us confidence in understanding exactly what was done.
(,IF THIS HELPED CAN YOU GIVE ME A BRAINYLEST PLEASE)
Reproducibility is important because it's the only thing that an investigator can guarantee about a study so reproducibility is important not because it ensures that the results are correct but rather because it ensures transparency and gives us confidence in understanding exactly what is done .
I hope this helped ; )
if aabb is mated to match aabb what is the probability that the offspring will have either the penotype aab-or the genotype aabb
When mating two parents with the genotype aabb, the offspring has a 50% chance of having either the phenotype aab- or the genotype aabb.
This is because half of the offspring will receive one allele from each parent, and half will receive two alleles from one parent. This means that the probability of having either the penotype aab- or the genotype aabb is 0.5 x 0.5 = 0.25, or 25%.
If two organisms with the genotype aabb are mated together, the probability that their offspring will have either the phenotype aab- or the genotype aabb is 50%.
This is because the probability of any one allele passing from parent to offspring is 50%. Therefore, the probability of both alleles passing from parent to offspring is 50% x 50% = 25%, giving the same probability for either of the two alleles passing from parent to offspring to be 50%.
To learn more about genotype, click here:
https://brainly.com/question/12116830
#SPJ4
Approximately how many different genes can be found in a human cell?
A.
more than a million
B.
less than one hundred
C.
more than one thousand
D.
less than ten
Answer:
C
Explanation:
I believe this is correct.
It contains between 20,000 and 25,000 genes.
Have a good day :)
Wolves living and hunting in packs is an example of:
A. Behavioral Adaption
B. Structural Adaption
C. Physiology Adaption
D. Hunting packs is not an adaption
Answer:
A.) Behavioral Adaption would be the answer!
which cells of the highlighted structure produce pancreatic juices? hepatocytes alpha beta acinar
The correct answer is option D.
The cells of the highlighted structure that produce pancreatic juices are Acinar cells.
Acinar cells are the cells of the pancreas that secrete pancreatic juice which contains enzymes required for the digestion of carbohydrates, proteins, and fats.
What is the pancreas?
The pancreas is an organ that is located behind the stomach. It has an endocrine function because it releases hormones directly into the bloodstream. Insulin and glucagon are the two main hormones that the pancreas produces that help regulate blood sugar levels.
The pancreas also has an exocrine function, which means it secretes digestive enzymes into the small intestine to help digest food. The cells that secrete pancreatic juice are called acinar cells, which are found in the pancreas.
If you need to learn more about pancreatic juice click here:
https://brainly.com/question/27856339
#SPJ11
A process which is essential to the whole species but not to an individual
member of that species is:
1. Digestion
2. Growth
3. Reproduction
4. Development
How would the world be without atoms?
without atoms, the chemical elements wouldn't exist. then, molecules, then proteins, then life itself. basically we're made out of atoms just like everything else.
What is the major component of cell membranes
all cell membranes are made of lipids
the major component of the cell membranes is phospholipids which are composed of glycerol that has a phosphate group attached to it and rests of fatty acids
What caused the tree bark to become darker?
Answer:
i would think pollution
Explanation:
cuz it might color the tree darker
What makes a species successful in an ecosystem?
Answer:
Beside the intensive loss of forest cover [2], fragmentation of the pristine remnants further affects species [3] and limits their ability to move into adequate areas. Thus the ability to cope with altered landscapes is crucial for the persistence of a species, especially in the face of climate change.
a dna segment has base order agc tta tcg. which copy exhibits a frameshift mutation through deletion?(1 point) responses tta tcg tta tcg agc tta tag agc tta tag agc ttt cg agc ttt cg agc tcg
AAGC TTT CG is a dna segment has base order agc tta tcg. which copy exhibits a frameshift mutation through deletion.
An organism's observable traits, or phenotype, may or may not change as a result of a mutation. Evolution, cancer, and the maturation of the immune system, including junctional variety, are among the normal and malignant biological processes in which mutations play a role. All genetic variety originates from mutation, which also provides the basis for the action of evolutionary forces like natural selection.
Sequence changes can take many distinct forms as a result of mutation. Gene mutations can have no effect, change the gene's product, or stop the gene from working fully or correctly.
To know more about mutation, click here,
brainly.com/question/14438201
#SPJ4
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
BRAINLIEST
William noticed that the sky was cloudy and wanted to see if he could predict the coming weather, so he recorded the barometric pressure throughout the day. He put his results in a chart.
Numbers in chart:
9:00 A.M. 30.55
11:00 A.M. 30.34
1:00 P.M. 30.01
3:00 P.M. 29.88
5:00 P.M. 29.88
William decided that the weather would be
Choose...
a. windy
b. clear
c. hot
d. stormy
because the barometric pressure was
Choose...
a. rising
b. stable
c. irregular
d. falling
.
Which of the following answer choices would be considered the
simplest?
Answer:
the smallest one
Explanation:
in humans, at what stage of the bacterial growth curve disease symptoms develop because the bacteria are causing tissue damage?
It is during the log phase of the bacterial growth curve that disease symptoms develop as a result of the bacteria causing tissue damage in humans.
The initial stage of bacterial growth is termed the lag phase, where bacteria are multiplying and adapting to the environment. The next stage is the log phase, where the bacteria are rapidly multiplying and the population size rapidly increases. Finally, the stationary phase is reached when the growth rate of the bacteria slows down and the population size begins to stabilize.
In terms of disease symptoms developing as a result of bacteria causing tissue damage, it is usually during the log phase that symptoms begin to become apparent. This is due to the fact that the bacteria population has now grown to a size where it can cause significant harm to the human body. As the bacteria multiply and spread, toxins are released which can cause inflammation and damage to the surrounding tissue. This damage can manifest itself in a variety of ways including pain, swelling, redness, vomiting, and diarrhea.
Learn more about log phase at :https://brainly.com/question/29749228
#SPJ4
James notices that a macro virus has been detected on a workstation in his organization. What was the most likely path for the infection
Answer:
A user intentionally enabled macros for an infected file
 hold your hand in front of your face. Look at it with one eye closed. Then with other explain why the image of your hand shifts
Answer:
when you look at your hand from one eye, then the other, the angle from which you're looking at your hand changes, causing it to look slightly different.
Question 3
When dissolved in water, many bases release which of the following particles?
Select one:
a. Htions
lil
b. H2 molecules
C. (OH) ions
DE
d. O molecules
CLE
Bases release OH- ions in solutions, whereas Acids release H+ ions in solutions
Describe a freshwater biome.
Define a wetland.
Why do wetlands have high biodiversity?
A developer wants to extend a golf course into a wetland. Outline environmental arguments you could make against this plan.
Freshwater biomes are large communities of plants and animals centered around waters with less than 1% salt concentration. They are very important to survival on Earth. Types of freshwater biomes include ponds, lakes, streams, rivers, and even some wetlands. Wetlands are not always considered freshwater biomes because they usually have too high of a salt content.
2.
Wetlands are areas where water covers the soil, or is present either at or near the surface of the soil all year or for varying periods of time during the year.
3.
Wetlands have been called “biological super systems” because they produce great volumes of food that support a remarkable level of biodiversity. In terms of number and variety of species supported, they are as rich as rainforests and coral reefs.
sorry last question i don't no
state the advantages of the liver
Which of the following components are arranged together to compose 97.5% of adult hemoglobin?
Check all that apply.
a. β-chain
b. α-chain
c. γ-chain
d. δ-chain
e. porphyrin ring
f. iron
An adult human's hemoglobin contains α and β chains, with the association of iron in a porphyrin ring. So options A, B, E, and F are correct.
The blood of an adult human contains red blood cells that have Hemoglobin. Hemoglobin as the name suggests, contains the 'Heme' part and the 'globin' part. Together, they form a quarternary structure.
The globin part is formed with the α and β chains, occurring in sets of two forming a condensed structure. The globin part holds the heme part at the center of each chain.
The heme part is formed of a porphyrin ring which associates with iron. This is very essential for the affinity of oxygen.
To learn more about Hemoglobin structure:
brainly.com/question/11916479
#SPJ4