you are studying the role of a newly discovered neurotransmitter. you find that there are receptors for this neurotransmitter on interneurons in the brain and that when it binds, it causes the opening of k channels. what can we expect of the postsynaptic cells under influence of this neurostransmitter?

Answers

Answer 1

The newly discovered neurotransmitter, when it binds to the receptors on interneurons in the brain, opens K channels. When the neurotransmitter binds to the receptor, it will cause the opening of K+ channels. Potassium ions move out of the cells, reducing the cells' resting membrane potential.

The opening of potassium channels, causing an outward movement of potassium ions from the cytosol to the extracellular space, can result in hyperpolarization. The binding of neurotransmitter to the receptor on interneurons in the brain leads to the opening of K channels, which causes the release of K ions. Due to the outward flow of K ions, there is a decrease in the intracellular concentration of positive ions.

The postsynaptic cells are expected to have a hyperpolarization response when under the influence of this neurotransmitter. When K channels open, K ions move out of the cells, causing a decrease in intracellular concentration. The process results in an increase in the difference between the inside and outside of the postsynaptic cell, which leads to hyperpolarization.

In conclusion, under the influence of this neurotransmitter, the postsynaptic cells are expected to hyperpolarize. Potassium ion concentration increases in the extracellular fluid as potassium ions move out of the cell. This phenomenon leads to the hyperpolarization of the postsynaptic cell, which is important in the functioning of the nervous system.

For more such questions on Neurotransmitter.

https://brainly.com/question/30972815#

#SPJ11


Related Questions

A mutant p53 gene can lead to the production of a ______, which in turn results in ______

Answers

A "faulty transcription factor" produced by a mutated p53 gene, prevents the transcription or translation of a polypeptide that prevents cell proliferation.

Tumor suppressor,p53 gene:

The p53 gene, a tumor suppressor is frequently inactivated during the tumorigenic process. The p53 gene is often altered, producing a persistent mutated polypeptide whose development is thought to be a characteristic of cancer cells. In contrast to losing their tumor-suppressing properties, mutant p53 proteins frequently acquire new carcinogenic properties that provide cancer cells an edge in terms of both survival and proliferation. It is fascinating to note that p53 gene mutations have been linked to several stages of the multi-step malignant transformation process, each of which contributes differently to tumor start, amplification, competitiveness, and migration.

Learn more about the p53 gene here:

https://brainly.com/question/19581609

#SPJ4

The cell-cycle control system initiates chromosome segregation only after:
cytokinesis is complete.
the DNA has been completely replicated and the chromosomes have decondensed.
M phase is complete.
the cell stops growing.
the duplicated chromosomes are correctly aligned on the mitotic spindle.

Answers

The cell-cycle control system initiates chromosome segregation only after the duplicated chromosomes are correctly aligned on the mitotic spindle.

This is a crucial step in ensuring that each daughter cell receives a complete and accurate set of chromosomes. The mitotic spindle is responsible for physically separating the duplicated chromosomes, which are held together by protein complexes called cohesins.

Once the chromosomes are aligned and attached to the spindle fibers, the spindle fibers can exert tension on the cohesins, breaking them apart and allowing the chromosomes to be pulled apart into separate daughter cells. This process occurs during the M phase of the cell cycle, which is the stage of cell division. Prior to M phase, the cell must undergo DNA replication and chromosome condensation to prepare for division.

Additionally, the cell must stop growing and enter a state of readiness for division, which is regulated by various checkpoint mechanisms. Overall, the cell-cycle control system plays a critical role in coordinating all of these processes to ensure that chromosome segregation occurs accurately and efficiently.

Learn more about chromosome segregation :

https://brainly.com/question/31237069

#SPJ11

A scientist is investigating a specimen in a laboratory. She is attempting to determine whether it is a virus or not. Which of the following would allow her to conclude that it is not a virus?

A. The specimen contains DNA and RNA
B. The specimen is extremely small
C. The specimen has a protein coat
D. The specimen has no organelles

Answers

A- the specimen contains DNA and RNA

Esther was on the YMCA diving team. She was on the 30 meter platform preparing to do a dive. If Esther's mass was 50 kg and she hit the water with a force of 980 N, what was her acceleration?

Answers

The acceleration of Esther on the YMCA was found to be about 19.6 m/s^2

What are the three acceleration laws?

Unless pushed upon by a force, every item travels in a straight line. An object's acceleration is directly proportional to the net force applied and inversely proportional to the object's mass. There is an equal and opposite reaction to every action.

In basic terms, what is acceleration?

Acceleration is the rate at which velocity varies over time, both in terms of speed and direction. A point or object travelling in a straight path is accelerated if it accelerates or decelerates. Even if the speed is constant, motion on a circle is accelerated because the direction is constantly changing.

as per the formula F=ma

then this formula was rewritten as a=F/m

where m= mass = 50Kg

F= force exerted =980N

acceleration (a) = 980/50

a =19.6 m/s^2

The acceleration of Esther on the YMCA was found to be about 19.6 m/s^2

To learn more about acceleration follow the given link: https://brainly.com/question/25876659

#SPJ1

What am I going to do or apply to protect and promote healthy sexuality?

Answers

Contraction fitness is an critical a part of bodily and intellectual fitness.

It is a key a part of our identification as humans collectively with the essential human rights to privacy, a own circle of relatives life, and dwelling unfastened from discriminatio .

Contraction fitness is a large a part of life. It can have an effect on and is tormented by different factors of fitness. This consists of bodily, intellectual, emotional, and social fitness.

Being in accurate contract fitness method you're properly informed, careful, and respectful to your self and others. Inform them approximately the terrible outcomes of youngsterager intercourse for each bodily and intellectual fitness. Also, tell them of the contract transmitted illnesses inclusive of aids, HIV, and so forth from such unprotected sexual activity.

Read more about health;

https://brainly.com/question/4784548

#SPJ4

the premature separation of the implanted placenta is called:

Answers

The premature separation of the implanted placenta from the uterine wall is called placental abruption. Placental abruption is a potentially serious condition that occurs during pregnancy, usually in the third trimester. It involves the detachment of part or all of the placenta before the baby is delivered.

Placental abruption can lead to various complications, including bleeding, abdominal pain, and potentially jeopardizing the oxygen and nutrient supply to the developing fetus. It is considered a medical emergency and requires immediate medical attention.

The exact cause of placental abruption is often unknown, but certain risk factors may increase the likelihood, such as high blood pressure, trauma to the abdomen, smoking, drug use, advanced maternal age, or a previous history of placental abruption.

Prompt diagnosis and management of placental abruption are crucial to ensure the well-being of both the mother and the baby. Treatment may involve close monitoring, bed rest, medication, and in severe cases, early delivery of the baby through cesarean section.

To know more about the placental abruption refer here,

https://brainly.com/question/31237130#

#SPJ11

The term that refers to presence of flagella at both poles of a cell is ... A. amphitrichous. B. atrichous. C. lophotrichous. D. monotrichous.

Answers

The term that refers to the presence of flagella at both poles of a cell is amphitrichous.

The correct option is A .

In general , amphitrichous has a meaning as "Amphi-" means "both," and "-trichous" means "having hair-like projections" or flagella in this case.

This arrangement of flagella allows the bacterium to move in either direction, as the flagella can propel the cell in opposite directions. Examples of bacteria with amphitrichous flagella include Vibrio cholerae and Pseudomonas aeruginosa.

Hence , A is the correct option

To learn more about amphitrichous , here

brainly.com/question/31056128

#SPJ4

in drought conditions, many plants aren't able to survive because they do not have enough water to photosynthesize. which step in photosynthesis would be blocked by drought conditions?

Answers

In drought conditions, the step of photosynthesis that would be blocked is the light-dependent reactions which take place in the thylakoid membrane of the chloroplast.

Photosynthesis is the process by which green plants and some other organisms utilize sunlight to synthesize foods with the aid of chlorophyll pigments, carbon dioxide, and water. Photosynthesis in plants is carried out by organelles called chloroplasts, which contain chlorophyll pigment. Chloroplasts convert light energy into chemical energy in the form of ATP by using photosystems 1 and 2, which are complex arrangements of pigments and proteins.

The ATP produced is used in the dark reactions of photosynthesis (also known as the Calvin cycle), which occur in the stroma of the chloroplasts. The dark reactions take carbon dioxide and water to make sugars, with oxygen gas as a by-product. The process of photosynthesis can be divided into two parts: light-dependent reactions and light-independent reactions.

Light-dependent reactions: During light-dependent reactions, energy is obtained from sunlight and converted into chemical energy in the form of ATP, which is used in light-independent reactions. This process takes place in the thylakoid membrane of the chloroplasts. It is during this process that water is split into oxygen and hydrogen ions.

Light-independent reactions: During light-independent reactions, chemical energy in the form of ATP is used to convert carbon dioxide to glucose. This process takes place in the stroma of the chloroplasts.

To learn more about photosynthesis visit;

https://brainly.com/question/29764662

#SPJ11

1. cats are the only host in which toxoplasma can sexually reproduce. therefore, cats are the _______ host for this protozoan.

Answers

Cats are the primary/definitive host for this protozoan.

There are different types of interactions between two species like mutualism, predation, parasitism, commensalism, etc.

Parasites are the organisms that live in/on another organism (host) and derive benefits like food and shelter from it.

The parasites usually harm the host, in some cases even causing their death.

Most of the parasites are species-specific. They can survive only inside the host of a particular species.

But some parasites require more than one host to complete their life cycle. Usually, in such cases, they reproduce asexually in one host and sexually in the other host/hosts.

The host in which they reproduce sexually is known as the primary/definitive host and  the host in which they reproduce asexually is known as the secondary/intermediate host.

As the cats are the only host in which toxoplasma can sexually reproduce, therefore, cats are the primary/definitive host for this protozoan.

To know more about "parasites/parasitism", refer to the link given below:

https://brainly.com/question/22589174?referrer=searchResults

#SPJ4

How does Rutherford’s model of the atom compare with Thomson’s model? They both describe atoms as small, indivisible spheres. They both describe electrons as moving around the nucleus. They both describe electrons as being surrounded by the positive matter. They both describe atoms as being made up of positive and negative matter.

Answers

Answer:

They both describe atoms as being made up of positive and negative matter.

Explanation:

Both Rutherford and Thomson's model both describe atoms as being made up of positive and negative matter. The correct option is D.

What is an atom?

An atom is a matter particle that truly represents a chemical element. An atom is made up of a central nucleus encased by one or more electrons. Each electron carries a negative charge.

Thomson's plum pudding the atom model contained negatively charged electrons within a positively charged "soup."

The gold foil experiment by Rutherford demonstrated that the atom is mostly empty space with a tiny, dense, positively charged nucleus. Rutherford proposed the nuclear model of the atom based on these findings.

Thus, the correct option is D.

For more details regarding atoms, visit:

https://brainly.com/question/1566330

#SPJ5

can someone can help me with this pls I need that right now

can someone can help me with this pls I need that right now

Answers

Answer:

1) chloroplast

2) chemical

3) photosynthesis

4) solar

5) roots

6) energy

7) glucose

8) oxygen

9) sugar

10) stoma

Explanation:

Here ya go, hope this helps you :)

which of these consumers might depend on plankton for its energy? krill orca rabbit seaweed PLEASE ANSWER ASAP

Answers

Answer:

Krill and orca are both consumers that depend on plankton for their energy. Krill are small, shrimp-like animals that are a major food source for many marine animals, including orcas. Orcas are large, apex predators that hunt in packs to catch krill and other small marine animals. Rabbits and seaweed are not consumers that depend on plankton for their energy. Rabbits are herbivores that eat plants, and seaweed is a plant that gets its energy from the sun.

Here is a table that shows the relationship between these consumers and plankton:

Consumer : Relationship to plankton

Krill: Plankton is a major food source

Orca: Plankton is a prey item

Rabbit: Plankton is not a food source

Seaweed: Plankton is not a food source

Comparing The integumentary system of a FROG with The integumentary system of aHUMAN???1.What are the differences in the frogintegumentary body system and that of ahuman integumentary body system?2.Then, what are the similarities in the frogintegumentary body system and that of ahuman integumentary body system?3. Then write a presentation comparing the frog to the human integumentary body system

Answers

The integumentary system is the definite structures creating the outmost part of body of an animal. The following are the differences of the frog and human integumentary system:

a. The integumentary system of a frog can take in water while the integumentary system of human is waterproof.

b. The frog's skin is important for thermoregulation and respiration while the human's skin is important for thermoregulation and protection.

c. The integumentary system of a frog consists the epidermis and dermis while the integumentary system of human consists of epidermis, dermis, and subcutaneous layer.

d. The skin of a frog harbors mucus and poisons while the skin of human harbors sweat and sebum.

e. The skin of the frog is thin, slippery and damp while the skin of human varies from dry to oily.

f. The skin of the frog consists of scales while the skin of human consists of fingernails and hair.

The fundamental difference between the frog and human integumantary system is their framewrok and specific purposes.

The distinct structures that make up an animal's outermost body part are known as its integumentary system.

What is Integumentary system?

The integumentary systems of frogs and humans differ in the following ways. The human integumentary system is waterproof, whereas the integumentary system of a frog can absorb water.

The skin of frogs is crucial for respiration and temperature regulation, whereas the skin of humans is crucial for both protection and temperature regulation.

The epidermis and dermis make up the integumentary system of a frog, whereas the epidermis, dermis, and subcutaneous layer make up the integumentary system of a human. A frog's skin contains mucus and toxins, whereas a human's skin contains perspiration and sebum.  

Therefore, The distinct structures that make up an animal's outermost body part are known as its integumentary system.

To learn more about Integumentary system, refer to the link:

https://brainly.com/question/29138376

#SPJ1

think about photosynthesis and cellular respiration

• identify what form carbon takes after the light-dependent reaction of photosynthesis

• identify what form carbon takes after cellular respiration

pls help

Answers

Explanation:

The Calvin cycle takes place in the stroma and uses the ATP and NADPH from the light-dependent reactions to fix carbon dioxide, producing three-carbon sugars—glyceraldehyde-3-phosphate, or G3P, molecules. The Calvin cycle converts ATP to ADP and Pi, and it converts NADPH to NADP+.

all of the following statements about organelles are true EXCEPT
a) ribosomes are the sites of protein synthesis
b) golgi apparatus contains powerful oxidative enzymes and also package cell products
c) the nucleus provides physical separation between transcription and translation
d) centrioles function in cell division

Answers

Answer:

b) golgi apparatus contains powerful oxidative enzymes and also package cell products

Explanation:

The Golgi apparatus is a cellular organelle responsible for protein modification, package, and transport. The organelle is made up of a series of flattened sacs. These sacs bud off into vesicles. The Golgi packages the proteins into vesicles so that they can be transported to their destination.

The peroxisome contains powerful oxidative enzymes, responsible for breaking down lipids.

Assess the following theories and determine which best explains the evolutionary advantages of habituation.
Select one:
a. Habituation improves an animal's odds of survival because the habituated animal will not waste energy investigating novel objects.
b. Habituation allows an animal to tune out unimportant stimuli and focus on things that are essential to survival or reproduction.
c. Habituation enables an animal to generalize from bad experiences and avoid similar situations in the future.
d. An animal that becomes habituated to a stimulus learns from repeated exposure that positive outcomes, such as food, are associated with the stimulus.

Answers

Best Explanation of Evolutionary Advantages of Habituation: Option B - Habituation allows an animal to tune out unimportant stimuli and focus on things that are essential to survival or reproduction.

1. Habituation refers to the process by which an animal becomes accustomed to a repeated or constant stimulus and gradually reduces or eliminates its response to that stimulus.

2. Option A suggests that habituation improves an animal's odds of survival because the habituated animal will not waste energy investigating novel objects. While this may be true to some extent, it does not fully explain the evolutionary advantages of habituation.

3. Option B states that habituation allows an animal to tune out unimportant stimuli and focus on things that are essential to survival or reproduction. This explanation aligns with the concept of selective attention, where an animal can prioritize relevant information and ignore irrelevant or non-threatening stimuli. By filtering out non-essential stimuli, the animal can allocate its limited resources more efficiently, such as energy and attention, towards activities that directly contribute to its survival or reproductive success.

4. Option C proposes that habituation enables an animal to generalize from bad experiences and avoid similar situations in the future. While this can be a potential advantage of habituation, it does not fully capture the evolutionary benefits of the process.

5. Option D suggests that an animal that becomes habituated to a stimulus learns from repeated exposure that positive outcomes, such as food, are associated with the stimulus. While this may be true in some cases, it does not encompass the broader advantages of habituation in terms of selective attention and efficient resource allocation.

In conclusion, option B provides the best explanation for the evolutionary advantages of habituation as it highlights the ability of animals to filter out unimportant stimuli and prioritize essential information for survival and reproduction.

For more such questions on reproduction, click on:

https://brainly.com/question/15457274

#SPJ8

Which of the following would not provide a person with complete protein or complimentary protein if eaten together

a. summer squash and tomatoes
b. kidney beans and rice
c. peanut butter and jelly on wheat bread
d. cereal and milk

Answers

On the other hand, complementary proteins are incomplete proteins that can be eaten together to provide all essential amino acids. the item that does not provide a person with complete protein or complementary protein if eaten together is (a) summer squash and tomatoes.

Protein is an important macronutrient that plays an important role in many physiological processes in the body. Proteins are the body's building blocks, and they help to repair, rebuild, and maintain muscle, bone, and other tissues. They are made up of amino acids, which are the building blocks of protein. Amino acids are involved in a variety of biological functions, including hormone and enzyme production, immune function, and nutrient absorption.What is a complementary protein?Complementary proteins are a combination of two or more incomplete proteins that provide all of the essential amino acids in the right proportions. Complementary proteins are generally found in plant-based diets, which are often low in certain amino acids. Complementary proteins can be found in a variety of plant-based foods, including beans and rice, lentils and barley, and corn and beans.A complete protein is a protein that contains all nine essential amino acids in the appropriate proportions. Complete proteins are often found in animal-based diets, such as meat, fish, eggs, and dairy products. Plant-based diets, on the other hand, tend to be low in certain essential amino acids, making it difficult for vegans and vegetarians to get the nutrients they need from their diets.To summarize, (a) summer squash and tomatoes do not provide a person with complete protein or complementary protein if eaten together. Kidney beans and rice, peanut butter and jelly on wheat bread, and cereal and milk all contain complementary proteins that can be eaten together to provide all essential amino acids in the right proportions.

learn more about macronutrient Refer: https://brainly.com/question/11460512

#SPJ11

The fact that water heats and cools more slowly than land causes many different types of weather. What is the primary source of heat for land and water?

A. heat from inside the Earth
B. energy from electricity
C. energy from the Sun
D. heat from friction in the air

Answers

C: energy from the sun

The primary source of heat for land and water is c. energy from the Sun as it is the only primary source of energy on earth.

How does water molecules get heated?

When water molecules are heated, they change freely with the air in a procedure referred to as evaporation. Ocean water is continuously evaporating, growing the temperature and humidity of the encircling air to shape rain and storms which can be then carried through alternate winds.

Because water has a far better warmness capacity, or precise heat , than do sands, soils or different materials, for a given quantity of sun irradiation (insolation), water temperature will boom much less than land temperature.The heat supply for our planet is the solar. Energy from the solar is transferred thru area and thru the earth's surroundings to the earth's floor. Since this energy warms the earth's floor and surroundings, a number of it's miles or turns into solar energy .

Read more about the temperature :

https://brainly.com/question/24746268

#SPJ2

Which of these events happens during G2 phase in the cell cycle?

A. The cell's DNA is checked for errors in replication.

B. The cell grows in size by adding cytoplasm and cell organelles.

C. All of a cell's chromosomes are copied when DNA replicates.

D. The nucleus of a cell divides into two identical nuclei.​

Answers

Answer:

it's B.

Explanation:

The cell is getting ready to split so it has to get big enough to split well.

Answer:all of a cell's chromosomes are copied when DNA replicates

Explanation:)

The pulmonary circulation carries blood between the heart and ______

Answers

Answer:

lungs

Explanation:

Pulmonary circulation moves blood between the heart and the lungs. It transports deoxygenated blood to the lungs to absorb oxygen and release carbon dioxide. The oxygenated blood then flows back to the heart. Systemic circulation moves blood between the heart and the rest of the body.

SOMEONE HELP IM NOT SURE WITH MY ANSWER


What condition can disrupt the cycles in an ecosytem?

a. clean environment

b. food and water

c. pollution

d. reforestation

Answers

Answer:

i think

option C

pollution

It's option C.

Since all other options are beneficial for our environment

what is the biodiversity score of farmland (maize)?

Answers

Answer:

Required Answer:-

The intensification of agriculture has caused dramatic declines in farmland biodiversity (Carvalheiro et al., 2013; Senapathi et al., 2015). Since the 1990s, agricultural policies have been developed in Europe to mitigate this loss through agri-environmental schemes (AES). One AES is “sown wildflower strips”, the aim of which is to create new ecological infrastructures by sowing attractive wild flowers on arable land (a few % of the cultivated area). These ecological infrastructures fall within our definition of MIMS since they represent a massive introduction of managed species in the landscape.

1. Select a professional athlete with a current or recent injury (within

last 6 months) who required/requires taping and/or wrapping to

return to play/train.


For my kinesiology class, I need to find a professional athlete who experiences/experienced a recent injury within the last 6 months, and as a result requires the use of taping and or wrapping to return to play/train.

Answers

One example of a professional athlete who experienced a recent injury and required taping and wrapping to return to play/train is Anthony Davis.

What is meant by professional athlete?

Professional athletes are the people who have natural talent, stamina and competitive drive.

One example of professional athlete who experienced recent injury and required taping and wrapping to return to play/train is Anthony Davis, a basketball player for the Los Angeles Lakers.

In February 2021, Davis suffered a calf strain and aggravation of Achilles tendon injury, which caused him to miss several games. When he returned to play, he was seen wearing kinesiology tape on his lower leg to provide support and stability to injured area. The tape helps to reduce pain, swelling and inflammation and also improving joint function and muscle activation. By using kinesiology tape, Davis was able to continue playing while recovering from his injury.

To know more about athlete, refer

https://brainly.com/question/1532968

#SPJ1

Examine the comparison between a eukaryotic cell and a prokaryotic cell. Which two lettered choices provide a comparison of structures that encode genetic information for the cells?.

Answers

Organisms called eukaryotes have nuclei and membrane-bound organelles in their cells. Its C and D

What is meant by eukaryotic cell ?

Organisms called eukaryotes have nuclei and membrane-bound organelles in their cells. The majority of algae, all animals, plants, fungi, and protists are eukaryotic organisms. Eukaryotes are multicellular or unicellular organisms.

Large and complex creatures are made up of eukaryotic cells, which have a nucleus surrounded by the nuclear membrane. Eukaryotic cells are found in fungi, plants, mammals, and protozoa. They are categorised as belonging to the Eukaryote kingdom.

Eukaryotic cells can also have other organelles outside the nucleus, such as mitochondria, chloroplasts, the endoplasmic reticulum, the Golgi apparatus, and lysosomes. Each of these organelles carries out a distinct task that is essential to the survival of the cell

The complete question is : Examine the comparison between a eukaryotic cell and a prokaryotic cell. Which two lettered choices provide a comparison of structures that encode genetic information for the cells? A) A and D B) B and D C) C and D D) None of these choices, as prokaryotic cells do not contain DNA

I am almost certain it is A) a and d) but I need reassurance.

To learn more about Eukaryotic cell refer to :

https://brainly.com/question/2088739

#SPJ4

Examine the comparison between a eukaryotic cell and a prokaryotic cell. Which two lettered choices provide

Consider the following mRNA molecule:

AUGUUUGAUUUAAACCAAUGA.

You are trying to generate the longest polypeptide from the mRNA molecule. Assume translation can start at any codon, not just AUG. Which starting point would

generate the longest polypeptide, having the reading frame for translation start at the first A, the first U, or the first G?

Answers

Starting at the first A would generate the longest polypeptide from the mRNA molecule.

To determine which starting point would generate the longest polypeptide, we need to identify the correct reading frame for translation. In mRNA, codons are read in sets of three nucleotides. Starting at different positions can lead to different reading frames, resulting in different amino acid sequences.Given the mRNA sequence AUGUUUGAUUUAAACCAAUGA, we can try translating it with three different starting points: the first A, the first U, and the first G.If we start at the first A (AUG), the codons would be AUG-UUU-GAU-UUA-ACC-AAU-GA. This would result in a polypeptide with the sequence Met-Phe-Asp-Leu-Thr-Asn.If we start at the first U (UGU), the codons would be UGU-UUG-AUU-UAA-ACC-AAU-GA. This would result in a polypeptide with the sequence Cys-Leu-Ile-Stop-Thr-Asn.If we start at the first G (GAU), the codons would be GAU-UUA-ACC-AAU-GA. This would result in a polypeptide with the sequence Asp-Leu-Thr-Asn.Based on the analysis, starting at the first A generates the longest polypeptide with six amino acids, while starting at the first U or G generates shorter polypeptides with five amino acids. Therefore, starting at the first A would generate the longest polypeptide.

For more questions on  molecule

https://brainly.com/question/475709

#SPJ8

what energy source contributes most to climate change

Answers

Greenhouse gases contributes the most

ill give your brainilest :)) (this is my last question!!)
In a certain species of plant, the color purple (P) is dominant to the color white (p). According to the Punnett Square, it is not possible for a plant offspring to be white.
True or false?

ill give your brainilest :)) (this is my last question!!)In a certain species of plant, the color purple

Answers

Punnett squares are used to get the expected genotypes and phenotypes of the progeny produced by a certain cross. The statement is TRUE. It is not possible for a plant offspring to be white.

What is a Punnett square?

The Punnett square is a graphic representation that shows the different types of gamete combinations according to the alleles involved in a cross.

Punnett square shows the probabilities of getting offspring with different genotypes and their consequent phenotypes.

In the exposed example,

P is dominant and codes for purplep is recessive and codes for white

Cross: PP  x  pp

Both parents are homozygous, one of them is homozygous dominant and the other one is homozygous recessive. They can only produce heterozygous individuals.

The statement is TRUE. It is not possible for a plant offspring to be white.

This is because, they carry both alleles, and the presence of one dominant allele is enough to express the dominant trait.

You can learn more about punnett squares at

https://brainly.com/question/15473888

#SPJ1

what is the difference between the nematocysts of a hydra and those of a sea anemone

Answers

Nematocysts are stinging cells that can be found in the phylum Cnidaria. These specialized cells can capture prey and deter predators. The hydra and sea anemone are two cnidarian species that possess nematocysts. While the nematocysts of hydra and sea anemone share similarities, they have some key differences.Nematocysts of a hydraHydra is a freshwater cnidarian that has a tube-like body and is a simple polyp.

Hydra has three types of nematocysts: spirocysts, microbasic mastigophores, and atrichous isorhizas. Each of these nematocysts have specific functions. For example, spirocysts help in wrapping the prey while microbasic mastigophores help in penetrating the prey's skin.Nematocysts of a sea anemoneSea anemones are marine cnidarians that have a sessile polyp body. They have a different type of nematocyst, acrorhagi. Acrorhagi are elongated nematocysts present on the oral disc and tentacles of sea anemones.

These nematocysts contain toxic threads that can be used as a weapon to attack other cnidarians. In addition to acrorhagi, sea anemones also possess spirocysts, microbasic mastigophores, and atrichous isorhizas, like hydra.To summarize, the nematocysts of hydra and those of sea anemone have a similar structure, but sea anemones also possess elongated nematocysts called acrorhagi that can be used as a weapon.

To know more about Nematocysts visit:-

https://brainly.com/question/984744

#SPJ11

In which type of nondisjunction could the two copies of a chromosome in a gamete be heterozygous?.

Answers

Gametes with two heterozygous copies of a chromosome may result from nondisjunction in either meiotic division.

What three types of nondisjunction are there?

Nondisjunction can take one of three different forms: failing to separate a homologous pair of chromosomes during meiosis I; failing to separate sister chromatids during meiosis II; or failing to separate sister chromatids during mitosis.

How can you tell whether nondisjunction takes place in meiosis 1 or 2?Nondisjunction, which can lead to an aberrant amount of chromosome-bearing gametes, can happen during meiosis I and meiosis II. The primary distinction between nondisjunction in meiosis 1 and 2 is that whereas sister chromatids fail to separate in meiosis II, homologous chromosomes fail to separate during meiosis 1.What are mitotic and meiotic divisions?Mitosis and meiosis are the two distinct processes of cell division.When people talk about "cell division," they typically mean mitosis, which is the process of creating new cells for the body. The cell division process known as meiosis is what produces egg and sperm cells. A vital process for life is mitosis.

learn more about Nondisjunction during meiosis here

https://brainly.com/question/14450336

#SPJ4

which step of nerve or muscle firing would be directly affected by a change in extracellular k ? g

Answers

Repolarization step of nerve or muscle firing would be directly affected by a change in extracellular k +

Repolarization refers to the change in membrane potential that returns it to a negative value just after the depolarization phase of an action potential which has changed the membrane potential to a positive value. The repolarization phase usually gets  back the surface potential back to the resting membrane potential. The efflux of potassium (K+) ions results in the falling phase of an action potential.

Learn more about Repolarization here:

https://brainly.com/question/3040056

#SPJ4

Other Questions
would ti be possible ot manufacture cel phones ni the united states fi a world crisis prevented ti from importing minerals and elements? yes no. what evidence from fig. 3.23 supports your answer? Use DeMoivre's theorem to find the two square roots of the following number in polar form38( cos 150 + sin 150)The square root with the smaller angle is (cos+)sinThe square root with the larger angle is (cos + sin)(Simplify your answers. Type integers or decimals. Type any angle measures in degrees. Use angle measures greater than or equal to 0 and less than 360.) a corporation was organized in january 2004 with authorized capital of $10 par value common stock. on february 1, 2004, shares were issued at par for cash. on march 1, 2004, the corporation's attorney accepted 7,000 shares of common stock in settlement for legal services with a fair value of $90,000. additional paid-in capital would increase on 2. basic facts about the wto the world trade organization (wto) was built on the basis of the general agreement on tariffs and trade (gatt) and, thus, inherited many of its features. still, the wto proved to be a very distinct institution. indicate whether each property in the following table is a unique property of the wto compared to gatt. property unique property of wto yes no limits participation to a few nations oversees tariff cuts and reduction of nontariff measures enforces dispute settlements enforces binding commitments acts as a government when can japan raise tariffs on imports from a country that is a member of the wto? whenever it wants to because japan is not a member of the wto never, because japan is a member of the wto when imports from that country threaten serious injury to japanese producers whenever it wants to as long as it has no free-trade agreement with that country what is the methodologies are defined as the methodologies offered by a research firm that is branded and does not provide information about how these methodologies work? What is the main focus of a marketing information system? TRUE/FALSE. the adolescent brain tends to have more mature pleasure-seeking systems and less advanced ability to deliberately control one's. Which sentence from Passage 2 supports the claim that Wu was an effective ruler? a team at jamison, inc., an advertising agency, is working on a new advertisement for a nutrition bar. the head of the team, luka, suggests that the advertisement should target primarily the rich. the team thinks this is a bad idea because the manufacturers are targeting a young market, and young people are unlikely to be rich. however, because of luka's argumentative nature, the team goes along with him, which results in the creation of an advertisement that the client rejects. which of the following is demonstrated in this scenario?A. with drawingB. blocking group C. facilitation groupD. think consensus A house is increased by 7% the house then had a value of 219350work out the price of the house before the increase Explain how a pile of ashes has the same mass as the original log before it was burned. Whatis the law that defines this (assuming a completely dry log and no combustable productsescaped in the air) called? A car is worth $15,000 when it is 1 year old, and it is worth $11,000 when it is 3 years old.A. Write the value of the car, V (in dollars), as a function of the age of the car, a (in years). Assume this is a linear function.B. How much does the car depreciate in value each year?C. How much was the car worth when it was first purchased? select all of the following descriptions that match what happens when a ferromagnetic material is placed in an external magnetic field. a. the ferromagnetic material becomes magnetized. b. nothing, ferromagnetic materials do not interact with magnetic fields. c. the ferromagnetic material becomes negatively charged. d. the ferromagnetic material becomes positively charged. e. the external magnetic field induces magnetic poles in the ferromagnetic material. f. the ferromagnetic material rapidly cools. what is hamilton's rule? view available hint(s)for part a what is hamilton's rule? a. br > c, meaning altruism occurs when its benefit to a relative times r, the coefficient of relatedness between the relative and the actor, outweighs the costs to the actor b. fr < fa, meaning the fitness of relatives is worth less than the actor's fitness, so altruism should never occur. c. an animal should help (be altruistic to) any infant regardless of whether they are related. d. altruism should only occur in certain species that meet key criteria. If 2x + 3y = 14 and xy = 8, then the value of 8x3 + 27y. Tap for more steps x = 7 3y 2 x = - 7 - 3 y Find the value of g(5) if g(t) = etu(t) * (8(t- 28(t 1)) - = e The value of g(5) is Please help me with my Math homework (about Angles) We purchased 300 pairs of Jordans at the beginning of the year for $100 per pair. During the year we sold 500 pairs for $300 each. We later ordered 300 more pairs at $110 each. Answer the following questions using this format $xx,xxx.00.What is our Cost of Goods sold using the FIFO method? dictyostelium discoideum is an unusual organism, one that straddles the boundary between the unicellular and the multicellular. its feeding phase consists of individual amoeba-like cells that move independently, feeding on bacteria by phagocytosis. when the food runs out, cells begin to aggregate into a multicellular structure that migrates toward light. the cells then differentiate into a base, stalk, and spores. only the spores survive to colonize a new habitat. what is the advantage of forming spores? 1. Describe President Andrew Jackson's actions surrounding the Second National Bank. Yourresponse should identify Jackson's position on a national bank and explain his reasoning. Thendescribe the effect Jackson's position on the bank had on the nation's economy. (4 points)I